Incidental Mutation 'R3798:Fam43b'
ID272835
Institutional Source Beutler Lab
Gene Symbol Fam43b
Ensembl Gene ENSMUSG00000078235
Gene Namefamily with sequence similarity 43, member B
SynonymsOTTMUSG00000009974
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R3798 (G1)
Quality Score103
Status Not validated
Chromosome4
Chromosomal Location138394092-138396528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 138395098 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 304 (R304G)
Ref Sequence ENSEMBL: ENSMUSP00000100649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105032]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062902
Predicted Effect probably benign
Transcript: ENSMUST00000105032
AA Change: R304G

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100649
Gene: ENSMUSG00000078235
AA Change: R304G

DomainStartEndE-ValueType
Pfam:PID_2 71 265 3.4e-75 PFAM
low complexity region 306 315 N/A INTRINSIC
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,431,965 V237E probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Bbs9 T C 9: 22,638,769 S21P probably damaging Het
Btbd16 A G 7: 130,777,140 N5D probably benign Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cyld T C 8: 88,734,930 L662P probably damaging Het
Eif2ak4 C T 2: 118,474,083 R1530C probably damaging Het
Ip6k3 T C 17: 27,145,106 I323V probably benign Het
Itpr1 T C 6: 108,381,270 L599P probably damaging Het
Lancl1 G A 1: 67,034,144 T60I probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc8d T A 5: 105,812,489 I255N probably benign Het
Ndst1 A G 18: 60,713,166 F24L possibly damaging Het
Notch1 A T 2: 26,478,618 V553E probably benign Het
Nsd3 T A 8: 25,698,845 W69R probably damaging Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Pcm1 T C 8: 41,258,014 I107T possibly damaging Het
Pcnx3 G A 19: 5,678,668 Q422* probably null Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ptbp3 T C 4: 59,546,166 I9V probably benign Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slx4ip T A 2: 137,067,623 D109E probably benign Het
Tas2r118 T C 6: 23,969,823 K80E possibly damaging Het
Ttn T C 2: 76,894,743 probably benign Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vmn2r79 A G 7: 87,002,194 Y267C possibly damaging Het
Wdr90 T C 17: 25,850,498 S1194G probably benign Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Fam43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2128:Fam43b UTSW 4 138395988 missense possibly damaging 0.87
R2258:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2281:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2413:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2416:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2417:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3705:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3715:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3797:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3854:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3856:Fam43b UTSW 4 138395098 missense probably benign 0.25
R4639:Fam43b UTSW 4 138395967 missense possibly damaging 0.66
R4868:Fam43b UTSW 4 138395797 missense probably benign 0.32
R5129:Fam43b UTSW 4 138395472 nonsense probably null
R6176:Fam43b UTSW 4 138395211 missense probably damaging 0.99
R7296:Fam43b UTSW 4 138395841 missense probably damaging 1.00
R8280:Fam43b UTSW 4 138395970 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCGACCATTACAGTGAC -3'
(R):5'- AGTCTTCACCTGGGTCTACC -3'

Sequencing Primer
(F):5'- GACCATTACAGTGACCGCGAG -3'
(R):5'- TTCAGCGACTTCAAGCGG -3'
Posted On2015-03-25