Mutagenetix > Incidental Mutations

Incidental Mutation 'R3798:Adgrf3'

272836

Institutional Source

Beutler Lab

Gene Symbol

Adgrf3

Ensembl Gene

ENSMUSG00000067642

Gene Name

adhesion G protein-coupled receptor F3

Synonyms

Gpr113, LOC381628, PGR23

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3798 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30193431-30205722 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30196823 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 736 (I736V)

Ref Sequence

ENSEMBL: ENSMUSP00000085440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088117
AA Change: I736V

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: I736V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
low complexity region	403	415	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
GPS	632	684	2.68e-17	SMART
Pfam:7tm_2	687	935	1e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114774
AA Change: I736V

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110422
Gene: ENSMUSG00000067642
AA Change: I736V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
Pfam:DUF3497	417	609	1.1e-12	PFAM
GPS	631	683	2.68e-17	SMART
Pfam:7tm_2	686	934	5.3e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125367

SMART Domains

Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadsb	T	A	7: 131,431,965	V237E	probably damaging	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Bbs9	T	C	9: 22,638,769	S21P	probably damaging	Het
Btbd16	A	G	7: 130,777,140	N5D	probably benign	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Cyld	T	C	8: 88,734,930	L662P	probably damaging	Het
Eif2ak4	C	T	2: 118,474,083	R1530C	probably damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Ip6k3	T	C	17: 27,145,106	I323V	probably benign	Het
Itpr1	T	C	6: 108,381,270	L599P	probably damaging	Het
Lancl1	G	A	1: 67,034,144	T60I	probably damaging	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Lrrc8d	T	A	5: 105,812,489	I255N	probably benign	Het
Ndst1	A	G	18: 60,713,166	F24L	possibly damaging	Het
Notch1	A	T	2: 26,478,618	V553E	probably benign	Het
Nsd3	T	A	8: 25,698,845	W69R	probably damaging	Het
Olfr117	T	A	17: 37,660,106	I76F	probably damaging	Het
Pcm1	T	C	8: 41,258,014	I107T	possibly damaging	Het
Pcnx3	G	A	19: 5,678,668	Q422*	probably null	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Ptbp3	T	C	4: 59,546,166	I9V	probably benign	Het
Sacs	T	C	14: 61,206,121	V1872A	possibly damaging	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Slx4ip	T	A	2: 137,067,623	D109E	probably benign	Het
Tas2r118	T	C	6: 23,969,823	K80E	possibly damaging	Het
Ttn	T	C	2: 76,894,743		probably benign	Het
Vmn2r72	T	C	7: 85,738,077	S760G	probably benign	Het
Vmn2r79	A	G	7: 87,002,194	Y267C	possibly damaging	Het
Wdr90	T	C	17: 25,850,498	S1194G	probably benign	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het

Other mutations in Adgrf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03080:Adgrf3	APN	5	30196829	missense	probably benign	0.02
IGL03171:Adgrf3	APN	5	30196294	missense	probably damaging	1.00
R0010:Adgrf3	UTSW	5	30205609	splice site	probably benign
R0042:Adgrf3	UTSW	5	30197428	missense	probably damaging	1.00
R0140:Adgrf3	UTSW	5	30196381	missense	probably benign	0.19
R0617:Adgrf3	UTSW	5	30195080	missense	probably benign	0.25
R0748:Adgrf3	UTSW	5	30196876	missense	probably damaging	1.00
R1291:Adgrf3	UTSW	5	30199534	missense	probably damaging	0.99
R1330:Adgrf3	UTSW	5	30195095	missense	probably benign	0.24
R1468:Adgrf3	UTSW	5	30202229	splice site	probably benign
R1695:Adgrf3	UTSW	5	30203555	missense	probably benign	0.05
R1716:Adgrf3	UTSW	5	30197551	missense	probably benign	0.03
R1844:Adgrf3	UTSW	5	30199213	missense	probably damaging	0.96
R1935:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R1936:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R2059:Adgrf3	UTSW	5	30199491	missense	possibly damaging	0.91
R2656:Adgrf3	UTSW	5	30196438	missense	possibly damaging	0.96
R2913:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2914:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2987:Adgrf3	UTSW	5	30197360	missense	probably damaging	1.00
R3797:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3799:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3934:Adgrf3	UTSW	5	30200434	unclassified	probably benign
R4043:Adgrf3	UTSW	5	30204362	missense	probably benign	0.00
R4080:Adgrf3	UTSW	5	30197369	nonsense	probably null
R4575:Adgrf3	UTSW	5	30202257	missense	probably benign	0.00
R4754:Adgrf3	UTSW	5	30197617	critical splice acceptor site	probably null
R4819:Adgrf3	UTSW	5	30198444	missense	possibly damaging	0.66
R4893:Adgrf3	UTSW	5	30200478	missense	probably benign	0.00
R4991:Adgrf3	UTSW	5	30199148	missense	probably benign	0.26
R5686:Adgrf3	UTSW	5	30197306	missense	probably damaging	1.00
R5965:Adgrf3	UTSW	5	30205639	missense	probably benign	0.00
R5997:Adgrf3	UTSW	5	30198362	critical splice donor site	probably null
R6103:Adgrf3	UTSW	5	30196267	missense	probably damaging	1.00
R6244:Adgrf3	UTSW	5	30197533	missense	probably benign	0.17
R6409:Adgrf3	UTSW	5	30197314	missense	probably damaging	0.96
R6575:Adgrf3	UTSW	5	30196524	missense	possibly damaging	0.72
R6745:Adgrf3	UTSW	5	30203603	missense	probably benign	0.31
R6790:Adgrf3	UTSW	5	30196387	missense	probably benign	0.00
R6813:Adgrf3	UTSW	5	30197521	missense	probably damaging	0.96
R7202:Adgrf3	UTSW	5	30204380	nonsense	probably null
R7250:Adgrf3	UTSW	5	30195682	missense	probably damaging	1.00
R7353:Adgrf3	UTSW	5	30198497	missense	probably damaging	0.98
R7634:Adgrf3	UTSW	5	30202247	missense	probably benign	0.01
R7658:Adgrf3	UTSW	5	30197206	missense	probably benign	0.41
R8037:Adgrf3	UTSW	5	30199512	missense	probably damaging	1.00
R8281:Adgrf3	UTSW	5	30197303	missense	possibly damaging	0.46
Z1088:Adgrf3	UTSW	5	30199120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TTGGACAGCTGGTGGAAGAC -3'
(R):5'- CAGTGCATTTGCCAGCATC -3'

Sequencing Primer
(F):5'- CAAAAAGCAGCTGGTGGGCC -3'
(R):5'- GCATTTGCCAGCATCTCACAG -3'

Posted On

2015-03-25