Incidental Mutation 'R3798:Lrrc8d'
ID272837
Institutional Source Beutler Lab
Gene Symbol Lrrc8d
Ensembl Gene ENSMUSG00000046079
Gene Nameleucine rich repeat containing 8D
SynonymsLrrc5, 2810473G09Rik, 4930525N13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3798 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105699969-105832436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105812489 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 255 (I255N)
Ref Sequence ENSEMBL: ENSMUSP00000113603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060531] [ENSMUST00000120847] [ENSMUST00000127686] [ENSMUST00000154807] [ENSMUST00000156630]
Predicted Effect probably benign
Transcript: ENSMUST00000060531
AA Change: I255N

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057293
Gene: ENSMUSG00000046079
AA Change: I255N

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 5.6e-31 PFAM
Pfam:DUF3733 138 197 2e-24 PFAM
transmembrane domain 366 388 N/A INTRINSIC
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120847
AA Change: I255N

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113603
Gene: ENSMUSG00000046079
AA Change: I255N

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 385 2.2e-160 PFAM
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149831
Predicted Effect probably benign
Transcript: ENSMUST00000154807
SMART Domains Protein: ENSMUSP00000114662
Gene: ENSMUSG00000046079

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156630
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,431,965 V237E probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Bbs9 T C 9: 22,638,769 S21P probably damaging Het
Btbd16 A G 7: 130,777,140 N5D probably benign Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cyld T C 8: 88,734,930 L662P probably damaging Het
Eif2ak4 C T 2: 118,474,083 R1530C probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Ip6k3 T C 17: 27,145,106 I323V probably benign Het
Itpr1 T C 6: 108,381,270 L599P probably damaging Het
Lancl1 G A 1: 67,034,144 T60I probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ndst1 A G 18: 60,713,166 F24L possibly damaging Het
Notch1 A T 2: 26,478,618 V553E probably benign Het
Nsd3 T A 8: 25,698,845 W69R probably damaging Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Pcm1 T C 8: 41,258,014 I107T possibly damaging Het
Pcnx3 G A 19: 5,678,668 Q422* probably null Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ptbp3 T C 4: 59,546,166 I9V probably benign Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slx4ip T A 2: 137,067,623 D109E probably benign Het
Tas2r118 T C 6: 23,969,823 K80E possibly damaging Het
Ttn T C 2: 76,894,743 probably benign Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vmn2r79 A G 7: 87,002,194 Y267C possibly damaging Het
Wdr90 T C 17: 25,850,498 S1194G probably benign Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Lrrc8d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Lrrc8d APN 5 105811952 missense possibly damaging 0.60
IGL01327:Lrrc8d APN 5 105812265 missense probably damaging 1.00
IGL02148:Lrrc8d APN 5 105812387 missense possibly damaging 0.92
IGL02228:Lrrc8d APN 5 105811864 missense probably benign 0.44
IGL02551:Lrrc8d APN 5 105813548 missense possibly damaging 0.78
IGL02605:Lrrc8d APN 5 105826817 intron noncoding transcript
R0415:Lrrc8d UTSW 5 105811865 missense probably damaging 1.00
R1424:Lrrc8d UTSW 5 105826916 missense unknown
R1754:Lrrc8d UTSW 5 105812657 missense probably benign
R3411:Lrrc8d UTSW 5 105826706 intron noncoding transcript
R3605:Lrrc8d UTSW 5 105827007 missense unknown
R3705:Lrrc8d UTSW 5 105813475 missense probably damaging 1.00
R3951:Lrrc8d UTSW 5 105814276 missense probably benign 0.00
R4300:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R4953:Lrrc8d UTSW 5 105813368 missense probably damaging 1.00
R5211:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R5436:Lrrc8d UTSW 5 105812552 missense probably damaging 0.98
R5512:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5512:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5514:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5514:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5531:Lrrc8d UTSW 5 105797670 intron probably benign
R5929:Lrrc8d UTSW 5 105812606 missense probably damaging 0.98
R6063:Lrrc8d UTSW 5 105812126 missense probably benign 0.01
R6379:Lrrc8d UTSW 5 105812809 missense probably benign 0.08
R6431:Lrrc8d UTSW 5 105811760 missense probably damaging 1.00
R7127:Lrrc8d UTSW 5 105812963 missense probably damaging 1.00
R7682:Lrrc8d UTSW 5 105812791 missense probably damaging 1.00
R7821:Lrrc8d UTSW 5 105812344 missense probably damaging 1.00
RF003:Lrrc8d UTSW 5 105812641 missense probably damaging 1.00
X0024:Lrrc8d UTSW 5 105811745 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGTCAGTAGCAACTTTTGGTTC -3'
(R):5'- TTGATGAGCGTTTGGACCAC -3'

Sequencing Primer
(F):5'- AACGTGCTCCAAGGTTGAGC -3'
(R):5'- GCGTTTGGACCACATAGAGCTTATAG -3'
Posted On2015-03-25