Incidental Mutation 'R3798:Tas2r118'
ID272838
Institutional Source Beutler Lab
Gene Symbol Tas2r118
Ensembl Gene ENSMUSG00000043865
Gene Nametaste receptor, type 2, member 118
SynonymsmGR18, mt2r40, T2R18, Tas2r18
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3798 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location23969161-23970060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23969823 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 80 (K80E)
Ref Sequence ENSEMBL: ENSMUSP00000053700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062463]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062463
AA Change: K80E

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053700
Gene: ENSMUSG00000043865
AA Change: K80E

DomainStartEndE-ValueType
Pfam:TAS2R 1 297 4.6e-87 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily. These family members are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,431,965 V237E probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Bbs9 T C 9: 22,638,769 S21P probably damaging Het
Btbd16 A G 7: 130,777,140 N5D probably benign Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cyld T C 8: 88,734,930 L662P probably damaging Het
Eif2ak4 C T 2: 118,474,083 R1530C probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Ip6k3 T C 17: 27,145,106 I323V probably benign Het
Itpr1 T C 6: 108,381,270 L599P probably damaging Het
Lancl1 G A 1: 67,034,144 T60I probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc8d T A 5: 105,812,489 I255N probably benign Het
Ndst1 A G 18: 60,713,166 F24L possibly damaging Het
Notch1 A T 2: 26,478,618 V553E probably benign Het
Nsd3 T A 8: 25,698,845 W69R probably damaging Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Pcm1 T C 8: 41,258,014 I107T possibly damaging Het
Pcnx3 G A 19: 5,678,668 Q422* probably null Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ptbp3 T C 4: 59,546,166 I9V probably benign Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slx4ip T A 2: 137,067,623 D109E probably benign Het
Ttn T C 2: 76,894,743 probably benign Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vmn2r79 A G 7: 87,002,194 Y267C possibly damaging Het
Wdr90 T C 17: 25,850,498 S1194G probably benign Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Tas2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Tas2r118 APN 6 23969747 missense probably damaging 0.99
IGL02517:Tas2r118 APN 6 23969892 missense probably damaging 1.00
IGL03387:Tas2r118 APN 6 23969181 missense possibly damaging 0.71
PIT4382001:Tas2r118 UTSW 6 23969786 missense possibly damaging 0.61
R0241:Tas2r118 UTSW 6 23969339 missense probably damaging 1.00
R0241:Tas2r118 UTSW 6 23969339 missense probably damaging 1.00
R0544:Tas2r118 UTSW 6 23969401 missense probably damaging 0.97
R1438:Tas2r118 UTSW 6 23969423 missense possibly damaging 0.79
R1471:Tas2r118 UTSW 6 23969171 missense probably damaging 0.96
R1632:Tas2r118 UTSW 6 23969261 missense probably benign 0.21
R2096:Tas2r118 UTSW 6 23969913 missense possibly damaging 0.90
R2106:Tas2r118 UTSW 6 23969570 missense probably benign
R2903:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R2904:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R2905:Tas2r118 UTSW 6 23969802 missense possibly damaging 0.87
R4402:Tas2r118 UTSW 6 23969294 missense probably benign 0.11
R4647:Tas2r118 UTSW 6 23969468 missense probably damaging 1.00
R4707:Tas2r118 UTSW 6 23969226 missense probably benign 0.26
R4965:Tas2r118 UTSW 6 23969628 missense probably benign 0.41
R5114:Tas2r118 UTSW 6 23969210 missense probably benign 0.05
R5823:Tas2r118 UTSW 6 23969471 missense probably benign 0.04
R5834:Tas2r118 UTSW 6 23969877 missense probably benign 0.06
R6976:Tas2r118 UTSW 6 23969471 missense probably benign 0.04
R7335:Tas2r118 UTSW 6 23969750 missense probably damaging 1.00
X0062:Tas2r118 UTSW 6 23969440 missense probably damaging 1.00
Z1177:Tas2r118 UTSW 6 23969559 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGGTGACTAATTCCATCTGGATG -3'
(R):5'- AAGTTGCACAACGGTTGC -3'

Sequencing Primer
(F):5'- TTGACAAACAAGAAGCTATCAGAGC -3'
(R):5'- CACAACGGTTGCAGTGCTATTCAG -3'
Posted On2015-03-25