Incidental Mutation 'R3798:Alpk3'
ID 272840
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Name alpha-kinase 3
Synonyms Midori
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R3798 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80707348-80755360 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 80742501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 773 (P773T)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107348
AA Change: P773T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: P773T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151115
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,033,694 (GRCm39) V237E probably damaging Het
Adgrf3 T C 5: 30,401,821 (GRCm39) I736V possibly damaging Het
Basp1 C A 15: 25,364,398 (GRCm39) probably benign Het
Bbs9 T C 9: 22,550,065 (GRCm39) S21P probably damaging Het
Btbd16 A G 7: 130,378,870 (GRCm39) N5D probably benign Het
Csmd2 C T 4: 128,411,388 (GRCm39) P2469S probably benign Het
Cyld T C 8: 89,461,558 (GRCm39) L662P probably damaging Het
Eif2ak4 C T 2: 118,304,564 (GRCm39) R1530C probably damaging Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Ip6k3 T C 17: 27,364,080 (GRCm39) I323V probably benign Het
Itpr1 T C 6: 108,358,231 (GRCm39) L599P probably damaging Het
Lancl1 G A 1: 67,073,303 (GRCm39) T60I probably damaging Het
Lmf1 G A 17: 25,873,445 (GRCm39) V317M probably damaging Het
Lrrc8d T A 5: 105,960,355 (GRCm39) I255N probably benign Het
Ndst1 A G 18: 60,846,238 (GRCm39) F24L possibly damaging Het
Notch1 A T 2: 26,368,630 (GRCm39) V553E probably benign Het
Nsd3 T A 8: 26,188,873 (GRCm39) W69R probably damaging Het
Or2g25 T A 17: 37,970,997 (GRCm39) I76F probably damaging Het
Pcm1 T C 8: 41,711,051 (GRCm39) I107T possibly damaging Het
Pcnx3 G A 19: 5,728,696 (GRCm39) Q422* probably null Het
Phrf1 C T 7: 140,839,831 (GRCm39) R243* probably null Het
Ptbp3 T C 4: 59,546,166 (GRCm39) I9V probably benign Het
Sacs T C 14: 61,443,570 (GRCm39) V1872A possibly damaging Het
Slc35g3 A G 11: 69,651,743 (GRCm39) F103L probably benign Het
Slx4ip T A 2: 136,909,543 (GRCm39) D109E probably benign Het
Tas2r118 T C 6: 23,969,822 (GRCm39) K80E possibly damaging Het
Ttn T C 2: 76,725,087 (GRCm39) probably benign Het
Vmn2r72 T C 7: 85,387,285 (GRCm39) S760G probably benign Het
Vmn2r79 A G 7: 86,651,402 (GRCm39) Y267C possibly damaging Het
Wdr90 T C 17: 26,069,472 (GRCm39) S1194G probably benign Het
Xdh T C 17: 74,214,653 (GRCm39) E764G probably damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 80,727,757 (GRCm39) missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 80,745,401 (GRCm39) splice site probably benign
IGL01732:Alpk3 APN 7 80,707,390 (GRCm39) missense unknown
IGL01750:Alpk3 APN 7 80,742,030 (GRCm39) missense probably damaging 1.00
IGL01812:Alpk3 APN 7 80,749,950 (GRCm39) missense probably damaging 1.00
IGL02224:Alpk3 APN 7 80,726,616 (GRCm39) splice site probably benign
IGL02292:Alpk3 APN 7 80,727,653 (GRCm39) missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 80,728,255 (GRCm39) missense probably benign 0.03
IGL02517:Alpk3 APN 7 80,727,643 (GRCm39) missense probably benign 0.00
IGL02725:Alpk3 APN 7 80,743,358 (GRCm39) missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 80,743,507 (GRCm39) missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 80,728,352 (GRCm39) missense probably benign 0.00
IGL03102:Alpk3 APN 7 80,744,804 (GRCm39) critical splice donor site probably null
IGL03153:Alpk3 APN 7 80,743,143 (GRCm39) missense probably benign 0.00
IGL03255:Alpk3 APN 7 80,742,310 (GRCm39) missense probably benign 0.01
IGL03367:Alpk3 APN 7 80,744,738 (GRCm39) missense probably benign 0.01
FR4304:Alpk3 UTSW 7 80,727,510 (GRCm39) small insertion probably benign
FR4737:Alpk3 UTSW 7 80,727,510 (GRCm39) small insertion probably benign
IGL03097:Alpk3 UTSW 7 80,743,657 (GRCm39) missense probably benign 0.00
R0092:Alpk3 UTSW 7 80,742,301 (GRCm39) missense probably benign
R0254:Alpk3 UTSW 7 80,726,722 (GRCm39) missense probably benign 0.43
R0310:Alpk3 UTSW 7 80,728,358 (GRCm39) missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 80,717,701 (GRCm39) missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 80,753,975 (GRCm39) missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 80,742,327 (GRCm39) missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 80,728,348 (GRCm39) missense probably benign
R1146:Alpk3 UTSW 7 80,727,343 (GRCm39) missense probably damaging 0.99
R1146:Alpk3 UTSW 7 80,727,343 (GRCm39) missense probably damaging 0.99
R1168:Alpk3 UTSW 7 80,753,105 (GRCm39) missense probably damaging 1.00
R1306:Alpk3 UTSW 7 80,743,621 (GRCm39) missense probably damaging 1.00
R1822:Alpk3 UTSW 7 80,726,679 (GRCm39) nonsense probably null
R2173:Alpk3 UTSW 7 80,726,648 (GRCm39) missense probably damaging 1.00
R2350:Alpk3 UTSW 7 80,744,718 (GRCm39) missense probably damaging 1.00
R2414:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R2417:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R2885:Alpk3 UTSW 7 80,749,940 (GRCm39) missense probably damaging 1.00
R3004:Alpk3 UTSW 7 80,753,103 (GRCm39) nonsense probably null
R3796:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R3797:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R3799:Alpk3 UTSW 7 80,742,501 (GRCm39) missense probably benign 0.02
R3894:Alpk3 UTSW 7 80,728,138 (GRCm39) missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 80,744,703 (GRCm39) missense probably damaging 1.00
R4761:Alpk3 UTSW 7 80,753,916 (GRCm39) missense probably damaging 0.99
R5505:Alpk3 UTSW 7 80,728,309 (GRCm39) missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 80,745,184 (GRCm39) missense probably damaging 1.00
R5770:Alpk3 UTSW 7 80,728,310 (GRCm39) missense probably benign 0.02
R5941:Alpk3 UTSW 7 80,728,401 (GRCm39) missense probably damaging 1.00
R5964:Alpk3 UTSW 7 80,742,008 (GRCm39) missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 80,743,005 (GRCm39) missense probably benign 0.34
R6036:Alpk3 UTSW 7 80,743,005 (GRCm39) missense probably benign 0.34
R6066:Alpk3 UTSW 7 80,726,698 (GRCm39) missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 80,728,327 (GRCm39) missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 80,728,432 (GRCm39) missense probably benign 0.00
R7230:Alpk3 UTSW 7 80,743,042 (GRCm39) missense probably damaging 1.00
R7266:Alpk3 UTSW 7 80,742,328 (GRCm39) missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 80,728,202 (GRCm39) missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 80,726,660 (GRCm39) missense probably benign 0.29
R7411:Alpk3 UTSW 7 80,742,600 (GRCm39) missense probably benign 0.11
R7454:Alpk3 UTSW 7 80,728,310 (GRCm39) missense probably benign 0.02
R7468:Alpk3 UTSW 7 80,750,746 (GRCm39) nonsense probably null
R7940:Alpk3 UTSW 7 80,743,693 (GRCm39) missense probably damaging 1.00
R8157:Alpk3 UTSW 7 80,743,470 (GRCm39) missense probably benign 0.00
R8246:Alpk3 UTSW 7 80,742,524 (GRCm39) missense probably benign 0.00
R8357:Alpk3 UTSW 7 80,743,066 (GRCm39) missense probably damaging 1.00
R8444:Alpk3 UTSW 7 80,707,468 (GRCm39) missense probably benign 0.08
R8457:Alpk3 UTSW 7 80,743,066 (GRCm39) missense probably damaging 1.00
R8775:Alpk3 UTSW 7 80,727,598 (GRCm39) missense probably benign 0.00
R8775-TAIL:Alpk3 UTSW 7 80,727,598 (GRCm39) missense probably benign 0.00
R8794:Alpk3 UTSW 7 80,707,403 (GRCm39) missense unknown
R8982:Alpk3 UTSW 7 80,748,750 (GRCm39) missense probably damaging 1.00
R9259:Alpk3 UTSW 7 80,743,302 (GRCm39) missense probably damaging 1.00
R9343:Alpk3 UTSW 7 80,742,079 (GRCm39) missense probably benign 0.27
R9567:Alpk3 UTSW 7 80,742,687 (GRCm39) missense possibly damaging 0.55
R9792:Alpk3 UTSW 7 80,750,881 (GRCm39) critical splice donor site probably null
R9793:Alpk3 UTSW 7 80,750,881 (GRCm39) critical splice donor site probably null
R9798:Alpk3 UTSW 7 80,742,400 (GRCm39) missense probably benign 0.02
RF034:Alpk3 UTSW 7 80,742,162 (GRCm39) small deletion probably benign
RF057:Alpk3 UTSW 7 80,742,165 (GRCm39) frame shift probably null
X0022:Alpk3 UTSW 7 80,743,645 (GRCm39) missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 80,728,374 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGTCAGACAGGAGTTCATGG -3'
(R):5'- TTCTTGGGGCACTGAGACAG -3'

Sequencing Primer
(F):5'- GTTCATGGAAGAATTTGGTGACAC -3'
(R):5'- GACAGGCTGTCCTCTTGC -3'
Posted On 2015-03-25