Incidental Mutation 'R3798:Btbd16'
ID272843
Institutional Source Beutler Lab
Gene Symbol Btbd16
Ensembl Gene ENSMUSG00000040298
Gene NameBTB (POZ) domain containing 16
SynonymsE330040A16Rik
Accession Numbers

Genbank: NM_001081038.2; Ensembl: ENSMUST00000048453

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3798 (G1)
Quality Score151
Status Not validated
Chromosome7
Chromosomal Location130774069-130825899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130777140 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 5 (N5D)
Ref Sequence ENSEMBL: ENSMUSP00000146849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048453] [ENSMUST00000124096] [ENSMUST00000207219] [ENSMUST00000208593]
Predicted Effect unknown
Transcript: ENSMUST00000048453
AA Change: N5D
SMART Domains Protein: ENSMUSP00000035433
Gene: ENSMUSG00000040298
AA Change: N5D

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Blast:BTB 97 222 3e-47 BLAST
SCOP:d1buoa_ 154 218 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057134
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207155
Predicted Effect unknown
Transcript: ENSMUST00000207219
AA Change: N5D
Predicted Effect probably benign
Transcript: ENSMUST00000208593
AA Change: N5D

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a BTB/POZ domain. This domain mediates protein-protein interactions. A mutation in this gene may be associated with bipolar disorder. [provided by RefSeq, Sep 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,431,965 V237E probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Bbs9 T C 9: 22,638,769 S21P probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cyld T C 8: 88,734,930 L662P probably damaging Het
Eif2ak4 C T 2: 118,474,083 R1530C probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Ip6k3 T C 17: 27,145,106 I323V probably benign Het
Itpr1 T C 6: 108,381,270 L599P probably damaging Het
Lancl1 G A 1: 67,034,144 T60I probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc8d T A 5: 105,812,489 I255N probably benign Het
Ndst1 A G 18: 60,713,166 F24L possibly damaging Het
Notch1 A T 2: 26,478,618 V553E probably benign Het
Nsd3 T A 8: 25,698,845 W69R probably damaging Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Pcm1 T C 8: 41,258,014 I107T possibly damaging Het
Pcnx3 G A 19: 5,678,668 Q422* probably null Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ptbp3 T C 4: 59,546,166 I9V probably benign Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slx4ip T A 2: 137,067,623 D109E probably benign Het
Tas2r118 T C 6: 23,969,823 K80E possibly damaging Het
Ttn T C 2: 76,894,743 probably benign Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vmn2r79 A G 7: 87,002,194 Y267C possibly damaging Het
Wdr90 T C 17: 25,850,498 S1194G probably benign Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Btbd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Btbd16 APN 7 130788822 missense probably damaging 1.00
IGL01020:Btbd16 APN 7 130824361 missense probably damaging 1.00
IGL01098:Btbd16 APN 7 130823245 missense probably damaging 1.00
IGL01412:Btbd16 APN 7 130805819 critical splice acceptor site probably null
1mM(1):Btbd16 UTSW 7 130821491 missense possibly damaging 0.86
R0063:Btbd16 UTSW 7 130823166 missense probably benign 0.25
R0063:Btbd16 UTSW 7 130823166 missense probably benign 0.25
R0147:Btbd16 UTSW 7 130779594 missense probably damaging 1.00
R0436:Btbd16 UTSW 7 130786053 missense probably benign 0.10
R0715:Btbd16 UTSW 7 130788827 missense probably damaging 1.00
R2127:Btbd16 UTSW 7 130784308 missense probably benign 0.17
R2411:Btbd16 UTSW 7 130790224 missense probably damaging 1.00
R5595:Btbd16 UTSW 7 130823303 missense possibly damaging 0.52
R5595:Btbd16 UTSW 7 130823304 missense probably damaging 1.00
R5839:Btbd16 UTSW 7 130815808 critical splice donor site probably null
R5933:Btbd16 UTSW 7 130784281 missense probably damaging 0.99
R6029:Btbd16 UTSW 7 130819072 missense probably benign 0.17
R7255:Btbd16 UTSW 7 130785992 missense probably benign 0.04
R7355:Btbd16 UTSW 7 130821443 missense probably benign 0.01
R7405:Btbd16 UTSW 7 130805856 missense probably benign 0.08
R7527:Btbd16 UTSW 7 130820472 missense probably damaging 1.00
R8151:Btbd16 UTSW 7 130797095 missense probably damaging 1.00
X0064:Btbd16 UTSW 7 130823170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCACATTTGAGGCTTTC -3'
(R):5'- TAGTATACAATGCTACGGAGGC -3'

Sequencing Primer
(F):5'- AGGCTTTCTCATGATTCCTTTTATGG -3'
(R):5'- ACGGAGGCATTCTCTACCATGTTAG -3'
Posted On2015-03-25