Incidental Mutation 'R3798:Ip6k3'
ID272857
Institutional Source Beutler Lab
Gene Symbol Ip6k3
Ensembl Gene ENSMUSG00000024210
Gene Nameinositol hexaphosphate kinase 3
SynonymsD830007E07Rik, Ihpk3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R3798 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27143969-27167764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27145106 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 323 (I323V)
Ref Sequence ENSEMBL: ENSMUSP00000025046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025046]
Predicted Effect probably benign
Transcript: ENSMUST00000025046
AA Change: I323V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025046
Gene: ENSMUSG00000024210
AA Change: I323V

DomainStartEndE-ValueType
Pfam:IPK 193 390 3e-68 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cerebellar Purkinje cell morphology, reduced synapse number, and defects in motor learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T A 7: 131,431,965 V237E probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Basp1 C A 15: 25,364,312 probably benign Het
Bbs9 T C 9: 22,638,769 S21P probably damaging Het
Btbd16 A G 7: 130,777,140 N5D probably benign Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cyld T C 8: 88,734,930 L662P probably damaging Het
Eif2ak4 C T 2: 118,474,083 R1530C probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itpr1 T C 6: 108,381,270 L599P probably damaging Het
Lancl1 G A 1: 67,034,144 T60I probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc8d T A 5: 105,812,489 I255N probably benign Het
Ndst1 A G 18: 60,713,166 F24L possibly damaging Het
Notch1 A T 2: 26,478,618 V553E probably benign Het
Nsd3 T A 8: 25,698,845 W69R probably damaging Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Pcm1 T C 8: 41,258,014 I107T possibly damaging Het
Pcnx3 G A 19: 5,678,668 Q422* probably null Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ptbp3 T C 4: 59,546,166 I9V probably benign Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slx4ip T A 2: 137,067,623 D109E probably benign Het
Tas2r118 T C 6: 23,969,823 K80E possibly damaging Het
Ttn T C 2: 76,894,743 probably benign Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vmn2r79 A G 7: 87,002,194 Y267C possibly damaging Het
Wdr90 T C 17: 25,850,498 S1194G probably benign Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Other mutations in Ip6k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Ip6k3 APN 17 27151060 missense probably benign
R0200:Ip6k3 UTSW 17 27145025 missense probably damaging 1.00
R0220:Ip6k3 UTSW 17 27145229 missense probably damaging 1.00
R1448:Ip6k3 UTSW 17 27145268 missense possibly damaging 0.90
R1749:Ip6k3 UTSW 17 27145079 missense probably benign 0.00
R1956:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R1957:Ip6k3 UTSW 17 27151168 missense probably benign 0.01
R3125:Ip6k3 UTSW 17 27157542 missense probably damaging 1.00
R3806:Ip6k3 UTSW 17 27145000 missense probably damaging 1.00
R4445:Ip6k3 UTSW 17 27145102 missense probably benign 0.10
R4506:Ip6k3 UTSW 17 27145180 missense possibly damaging 0.69
R4651:Ip6k3 UTSW 17 27145291 missense probably damaging 1.00
R5972:Ip6k3 UTSW 17 27149960 missense possibly damaging 0.48
R6119:Ip6k3 UTSW 17 27148625 missense possibly damaging 0.72
R7140:Ip6k3 UTSW 17 27144995 missense probably damaging 1.00
R7340:Ip6k3 UTSW 17 27148530 missense probably benign 0.00
R7811:Ip6k3 UTSW 17 27157583 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTCCAAGAAGCTTCATTCTCC -3'
(R):5'- TATGGAAGGAAGCTCTCGGTG -3'

Sequencing Primer
(F):5'- GAATCCCAATGAGGTTTTCCAGGC -3'
(R):5'- TGGAGGGATTCAGGCAAGCC -3'
Posted On2015-03-25