Mutagenetix > Incidental Mutation

Incidental Mutation 'R3798:Ndst1'

272860

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3798 (G1)

Quality Score

181

Status

Not validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60713166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 24 (F24L)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169273
AA Change: F24L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: F24L

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadsb	T	A	7: 131,431,965	V237E	probably damaging	Het
Adgrf3	T	C	5: 30,196,823	I736V	possibly damaging	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Basp1	C	A	15: 25,364,312		probably benign	Het
Bbs9	T	C	9: 22,638,769	S21P	probably damaging	Het
Btbd16	A	G	7: 130,777,140	N5D	probably benign	Het
Csmd2	C	T	4: 128,517,595	P2469S	probably benign	Het
Cyld	T	C	8: 88,734,930	L662P	probably damaging	Het
Eif2ak4	C	T	2: 118,474,083	R1530C	probably damaging	Het
Fam43b	G	C	4: 138,395,098	R304G	probably benign	Het
Ip6k3	T	C	17: 27,145,106	I323V	probably benign	Het
Itpr1	T	C	6: 108,381,270	L599P	probably damaging	Het
Lancl1	G	A	1: 67,034,144	T60I	probably damaging	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Lrrc8d	T	A	5: 105,812,489	I255N	probably benign	Het
Notch1	A	T	2: 26,478,618	V553E	probably benign	Het
Nsd3	T	A	8: 25,698,845	W69R	probably damaging	Het
Olfr117	T	A	17: 37,660,106	I76F	probably damaging	Het
Pcm1	T	C	8: 41,258,014	I107T	possibly damaging	Het
Pcnx3	G	A	19: 5,678,668	Q422*	probably null	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Ptbp3	T	C	4: 59,546,166	I9V	probably benign	Het
Sacs	T	C	14: 61,206,121	V1872A	possibly damaging	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Slx4ip	T	A	2: 137,067,623	D109E	probably benign	Het
Tas2r118	T	C	6: 23,969,823	K80E	possibly damaging	Het
Ttn	T	C	2: 76,894,743		probably benign	Het
Vmn2r72	T	C	7: 85,738,077	S760G	probably benign	Het
Vmn2r79	A	G	7: 87,002,194	Y267C	possibly damaging	Het
Wdr90	T	C	17: 25,850,498	S1194G	probably benign	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9526:Ndst1	UTSW	18	60705148	nonsense	probably null
R9552:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCCCAGCTGTGAATAAAG -3'
(R):5'- AGTCTCTGCATTTCTCAGTCAGTG -3'

Sequencing Primer
(F):5'- AGCTGTGAATAAAGGCTCTCC -3'
(R):5'- GCATTTCTCAGTCAGTGGACAGC -3'

Posted On

2015-03-25