Mutagenetix > Incidental Mutation

Incidental Mutation 'R3799:Pard3b'

272863

Institutional Source

Beutler Lab

Gene Symbol

Pard3b

Ensembl Gene

ENSMUSG00000052062

Gene Name

par-3 family cell polarity regulator beta

Synonyms

PAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L

MMRRC Submission

040877-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3799 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61638824-62642284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62161229 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 309 (N309S)

Ref Sequence

ENSEMBL: ENSMUSP00000092510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]

AlphaFold

Q9CSB4

Predicted Effect

probably benign
Transcript: ENSMUST00000046673
AA Change: N309S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: N309S

Domain	Start	End	E-Value	Type
Pfam:DUF3534	1	143	1.2e-66	PFAM
PDZ	211	291	1.5e-4	SMART
low complexity region	376	388	N/A	INTRINSIC
PDZ	391	470	2.5e-24	SMART
internal_repeat_1	479	515	4.63e-5	PROSPERO
low complexity region	527	537	N/A	INTRINSIC
low complexity region	594	601	N/A	INTRINSIC
low complexity region	677	688	N/A	INTRINSIC
coiled coil region	761	808	N/A	INTRINSIC
coiled coil region	839	866	N/A	INTRINSIC
low complexity region	1075	1083	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075374
AA Change: N309S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: N309S

Domain	Start	End	E-Value	Type
Pfam:DUF3534	1	143	8.2e-66	PFAM
PDZ	211	291	1.5e-4	SMART
low complexity region	376	388	N/A	INTRINSIC
PDZ	391	470	2.5e-24	SMART
low complexity region	487	498	N/A	INTRINSIC
PDZ	507	592	6.17e-15	SMART
low complexity region	656	663	N/A	INTRINSIC
low complexity region	739	750	N/A	INTRINSIC
coiled coil region	823	870	N/A	INTRINSIC
coiled coil region	901	928	N/A	INTRINSIC
low complexity region	1137	1145	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094906
AA Change: N309S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: N309S

Domain	Start	End	E-Value	Type
Pfam:DUF3534	1	143	1.1e-66	PFAM
PDZ	211	291	1.5e-4	SMART
low complexity region	376	388	N/A	INTRINSIC
PDZ	391	470	2.5e-24	SMART
low complexity region	487	498	N/A	INTRINSIC
PDZ	507	592	6.17e-15	SMART
low complexity region	656	663	N/A	INTRINSIC
low complexity region	739	750	N/A	INTRINSIC
coiled coil region	823	870	N/A	INTRINSIC
low complexity region	901	913	N/A	INTRINSIC
low complexity region	1038	1046	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188325

Meta Mutation Damage Score

0.1358

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A3galt2	A	G	4: 128,767,070	T140A	probably damaging	Het
Adgrf3	T	C	5: 30,196,823	I736V	possibly damaging	Het
Alpk3	C	A	7: 81,092,753	P773T	probably benign	Het
Ccna1	G	T	3: 55,050,619	T155K	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Dnah12	T	C	14: 26,770,923	W1214R	probably damaging	Het
Ehbp1l1	A	G	19: 5,719,115	V720A	probably benign	Het
Exog	T	G	9: 119,449,810	N186K	probably damaging	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Flnc	G	A	6: 29,443,739	V587M	probably damaging	Het
Gm1527	A	G	3: 28,926,596	N615S	possibly damaging	Het
Gm4858	A	T	3: 93,074,086	D137V	probably damaging	Het
Gm5799	G	A	14: 43,543,693	G17E	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Mastl	T	C	2: 23,140,492		probably benign	Het
Mogat1	A	G	1: 78,529,138	I216V	probably benign	Het
Nans	A	G	4: 46,492,839	E89G	probably benign	Het
Nuggc	T	A	14: 65,619,638	M396K	probably benign	Het
Nup214	T	C	2: 32,034,682	F236S	probably damaging	Het
Osbp2	T	C	11: 3,717,883	E145G	probably damaging	Het
Paqr3	T	C	5: 97,111,316	N43S	probably damaging	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Ralgapa1	T	C	12: 55,659,130	Y1869C	probably damaging	Het
Setd2	T	C	9: 110,549,571	V818A	probably benign	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Tcaf3	T	C	6: 42,597,080	E66G	probably damaging	Het
Tmem8b	A	G	4: 43,673,892		probably benign	Het
Trpa1	T	C	1: 14,893,264	N578S	possibly damaging	Het
Vmn2r25	A	T	6: 123,853,184	L3I	probably benign	Het
Vmn2r76	T	C	7: 86,226,036	T578A	probably benign	Het
Vwa8	T	A	14: 79,064,896	F1002I	probably damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Zfp518a	G	T	19: 40,915,310	V1228F	probably damaging	Het

Other mutations in Pard3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Pard3b	APN	1	62161198	missense	probably damaging	0.99
IGL01363:Pard3b	APN	1	62637640	missense	probably damaging	1.00
IGL01509:Pard3b	APN	1	62161248	missense	possibly damaging	0.54
IGL01611:Pard3b	APN	1	62637862	missense	probably damaging	0.96
IGL01651:Pard3b	APN	1	62479804	intron	probably benign
IGL01670:Pard3b	APN	1	62211648	missense	probably damaging	1.00
IGL02156:Pard3b	APN	1	61767950	missense	possibly damaging	0.84
IGL02232:Pard3b	APN	1	62166382	missense	probably damaging	1.00
IGL02450:Pard3b	APN	1	62532676	missense	possibly damaging	0.68
IGL03064:Pard3b	APN	1	62198771	splice site	probably benign
R0040:Pard3b	UTSW	1	62637820	missense	probably damaging	1.00
R0040:Pard3b	UTSW	1	62637820	missense	probably damaging	1.00
R0060:Pard3b	UTSW	1	61639315	missense	probably damaging	0.97
R0157:Pard3b	UTSW	1	62211633	missense	probably damaging	0.96
R0333:Pard3b	UTSW	1	62230212	missense	probably benign	0.00
R0448:Pard3b	UTSW	1	62166469	missense	probably damaging	1.00
R0465:Pard3b	UTSW	1	62211718	splice site	probably benign
R0497:Pard3b	UTSW	1	62440008	splice site	probably null
R1264:Pard3b	UTSW	1	62164157	missense	probably damaging	1.00
R1468:Pard3b	UTSW	1	62345029	missense	probably benign	0.00
R1468:Pard3b	UTSW	1	62345029	missense	probably benign	0.00
R1482:Pard3b	UTSW	1	62166367	missense	probably damaging	1.00
R1554:Pard3b	UTSW	1	62637894	missense	probably damaging	0.97
R1836:Pard3b	UTSW	1	62637604	missense	probably benign	0.03
R2005:Pard3b	UTSW	1	62144891	missense	probably benign	0.12
R2220:Pard3b	UTSW	1	62479683	nonsense	probably null
R2435:Pard3b	UTSW	1	62587738	missense	probably damaging	1.00
R3015:Pard3b	UTSW	1	62344878	missense	probably damaging	1.00
R3688:Pard3b	UTSW	1	62479569	missense	probably benign
R3712:Pard3b	UTSW	1	62343978	missense	probably damaging	1.00
R3942:Pard3b	UTSW	1	62159452	missense	probably damaging	1.00
R4683:Pard3b	UTSW	1	62216516	missense	probably benign
R4729:Pard3b	UTSW	1	62211684	missense	probably damaging	1.00
R4898:Pard3b	UTSW	1	61768000	missense	probably damaging	1.00
R4981:Pard3b	UTSW	1	62344060	missense	probably damaging	1.00
R5049:Pard3b	UTSW	1	62161161	missense	probably benign	0.01
R5223:Pard3b	UTSW	1	62344113	missense	probably damaging	1.00
R5476:Pard3b	UTSW	1	62010406	missense	probably benign	0.10
R5541:Pard3b	UTSW	1	61639343	missense	probably damaging	1.00
R5672:Pard3b	UTSW	1	62010466	missense	probably benign	0.11
R5714:Pard3b	UTSW	1	62637916	missense	probably null	0.99
R5722:Pard3b	UTSW	1	62440001	splice site	probably null
R5793:Pard3b	UTSW	1	61767973	missense	probably damaging	1.00
R5930:Pard3b	UTSW	1	61768130	intron	probably benign
R5950:Pard3b	UTSW	1	62216531	missense	probably benign	0.04
R5997:Pard3b	UTSW	1	62076409	missense	probably damaging	1.00
R6646:Pard3b	UTSW	1	62161121	missense	probably benign	0.32
R6720:Pard3b	UTSW	1	62159470	missense	probably damaging	0.99
R6809:Pard3b	UTSW	1	62161181	missense	probably damaging	1.00
R7148:Pard3b	UTSW	1	62440032	missense	probably benign	0.01
R7847:Pard3b	UTSW	1	62343934	missense	probably benign	0.00
R7879:Pard3b	UTSW	1	62159511	missense	possibly damaging	0.65
R8048:Pard3b	UTSW	1	62153989	missense	probably damaging	1.00
R8125:Pard3b	UTSW	1	61767984	missense	probably damaging	1.00
R8329:Pard3b	UTSW	1	62637798	missense	probably benign	0.30
R8766:Pard3b	UTSW	1	62159478	missense	probably benign	0.35
R8833:Pard3b	UTSW	1	62344999	missense	probably benign	0.00
R8889:Pard3b	UTSW	1	62637867	missense	probably damaging	0.97
R8892:Pard3b	UTSW	1	62637867	missense	probably damaging	0.97
R8907:Pard3b	UTSW	1	62344135	missense	probably benign	0.39
R8909:Pard3b	UTSW	1	62344135	missense	probably benign	0.39
R9215:Pard3b	UTSW	1	62164185	missense	probably damaging	1.00
R9310:Pard3b	UTSW	1	62166369	missense	probably damaging	0.99
R9542:Pard3b	UTSW	1	62211627	nonsense	probably null
Z1176:Pard3b	UTSW	1	62238892	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTTATGACACCAGGCTGC -3'
(R):5'- TTGCTGCCAAACCCCATGAG -3'

Sequencing Primer
(F):5'- TATGACACCAGGCTGCTCTGC -3'
(R):5'- TGCCAAACCCCATGAGAGGAG -3'

Posted On

2015-03-25