Incidental Mutation 'R3799:Mastl'
ID 272866
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Name microtubule associated serine/threonine kinase-like
Synonyms 2700091H24Rik, THC2
MMRRC Submission 040877-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3799 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 23115606-23156024 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 23140492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
AlphaFold Q8C0P0
Predicted Effect probably benign
Transcript: ENSMUST00000028119
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,767,070 T140A probably damaging Het
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Ccna1 G T 3: 55,050,619 T155K probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Dnah12 T C 14: 26,770,923 W1214R probably damaging Het
Ehbp1l1 A G 19: 5,719,115 V720A probably benign Het
Exog T G 9: 119,449,810 N186K probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Flnc G A 6: 29,443,739 V587M probably damaging Het
Gm1527 A G 3: 28,926,596 N615S possibly damaging Het
Gm4858 A T 3: 93,074,086 D137V probably damaging Het
Gm5799 G A 14: 43,543,693 G17E probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Mogat1 A G 1: 78,529,138 I216V probably benign Het
Nans A G 4: 46,492,839 E89G probably benign Het
Nuggc T A 14: 65,619,638 M396K probably benign Het
Nup214 T C 2: 32,034,682 F236S probably damaging Het
Osbp2 T C 11: 3,717,883 E145G probably damaging Het
Paqr3 T C 5: 97,111,316 N43S probably damaging Het
Pard3b A G 1: 62,161,229 N309S probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ralgapa1 T C 12: 55,659,130 Y1869C probably damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Tcaf3 T C 6: 42,597,080 E66G probably damaging Het
Tmem8b A G 4: 43,673,892 probably benign Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Vmn2r25 A T 6: 123,853,184 L3I probably benign Het
Vmn2r76 T C 7: 86,226,036 T578A probably benign Het
Vwa8 T A 14: 79,064,896 F1002I probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23146148 missense probably damaging 1.00
IGL02103:Mastl APN 2 23139998 missense probably benign 0.01
IGL02622:Mastl APN 2 23132845 missense probably benign 0.12
IGL02826:Mastl APN 2 23145409 missense probably damaging 1.00
IGL02896:Mastl APN 2 23131767 missense probably damaging 1.00
IGL03024:Mastl APN 2 23139919 missense probably damaging 1.00
IGL03038:Mastl APN 2 23140615 splice site probably benign
R0600:Mastl UTSW 2 23133346 missense probably benign 0.06
R0712:Mastl UTSW 2 23150993 missense probably damaging 1.00
R1168:Mastl UTSW 2 23133132 missense probably benign 0.06
R1750:Mastl UTSW 2 23146081 nonsense probably null
R1911:Mastl UTSW 2 23132680 nonsense probably null
R2051:Mastl UTSW 2 23132824 missense possibly damaging 0.49
R2859:Mastl UTSW 2 23139967 missense probably damaging 0.99
R3840:Mastl UTSW 2 23140551 missense probably damaging 1.00
R4807:Mastl UTSW 2 23132843 missense probably benign
R4818:Mastl UTSW 2 23137026 missense probably benign 0.00
R4845:Mastl UTSW 2 23139998 missense probably benign 0.01
R5338:Mastl UTSW 2 23133491 missense probably benign 0.01
R5364:Mastl UTSW 2 23133653 missense probably benign 0.16
R6077:Mastl UTSW 2 23155794 missense probably damaging 0.99
R6158:Mastl UTSW 2 23132772 missense possibly damaging 0.92
R6450:Mastl UTSW 2 23120929 missense probably damaging 1.00
R6602:Mastl UTSW 2 23132677 missense probably benign 0.04
R6788:Mastl UTSW 2 23133698 missense probably benign 0.22
R6908:Mastl UTSW 2 23155976 start gained probably benign
R7058:Mastl UTSW 2 23133413 nonsense probably null
R7233:Mastl UTSW 2 23133658 missense probably benign
R7249:Mastl UTSW 2 23146139 missense probably damaging 1.00
R7347:Mastl UTSW 2 23133389 missense probably damaging 0.99
R7371:Mastl UTSW 2 23140573 missense probably damaging 1.00
R7726:Mastl UTSW 2 23140795 splice site probably null
R8057:Mastl UTSW 2 23133554 missense possibly damaging 0.75
R8288:Mastl UTSW 2 23133359 missense probably damaging 1.00
R9101:Mastl UTSW 2 23118437 makesense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTACTAAGAGCTTCATCTTCAG -3'
(R):5'- TCCTATACCAGCCAGTTCTGTG -3'

Sequencing Primer
(F):5'- AGGCTCGGTACTTACATC -3'
(R):5'- ATACCAGCCAGTTCTGTGGGTAC -3'
Posted On 2015-03-25