Incidental Mutation 'R3799:Mastl'
ID 272866
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Name microtubule associated serine/threonine kinase-like
Synonyms THC2, 2700091H24Rik
MMRRC Submission 040877-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3799 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 23006549-23046036 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 23030504 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
AlphaFold Q8C0P0
Predicted Effect probably benign
Transcript: ENSMUST00000028119
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,660,863 (GRCm39) T140A probably damaging Het
Adgrf3 T C 5: 30,401,821 (GRCm39) I736V possibly damaging Het
Alpk3 C A 7: 80,742,501 (GRCm39) P773T probably benign Het
Ccna1 G T 3: 54,958,040 (GRCm39) T155K probably benign Het
Cops7a C T 6: 124,936,795 (GRCm39) R252H probably damaging Het
Dnah12 T C 14: 26,492,880 (GRCm39) W1214R probably damaging Het
Ehbp1l1 A G 19: 5,769,143 (GRCm39) V720A probably benign Het
Exog T G 9: 119,278,876 (GRCm39) N186K probably damaging Het
Fgfr1 G A 8: 26,062,453 (GRCm39) D663N probably damaging Het
Flnc G A 6: 29,443,738 (GRCm39) V587M probably damaging Het
Gm1527 A G 3: 28,980,745 (GRCm39) N615S possibly damaging Het
Gm5799 G A 14: 43,781,150 (GRCm39) G17E probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Mogat1 A G 1: 78,505,775 (GRCm39) I216V probably benign Het
Nans A G 4: 46,492,839 (GRCm39) E89G probably benign Het
Nuggc T A 14: 65,857,087 (GRCm39) M396K probably benign Het
Nup214 T C 2: 31,924,694 (GRCm39) F236S probably damaging Het
Osbp2 T C 11: 3,667,883 (GRCm39) E145G probably damaging Het
Paqr3 T C 5: 97,259,175 (GRCm39) N43S probably damaging Het
Pard3b A G 1: 62,200,388 (GRCm39) N309S probably benign Het
Phrf1 C T 7: 140,839,831 (GRCm39) R243* probably null Het
Ralgapa1 T C 12: 55,705,915 (GRCm39) Y1869C probably damaging Het
Setd2 T C 9: 110,378,639 (GRCm39) V818A probably benign Het
Slc35g3 A G 11: 69,651,743 (GRCm39) F103L probably benign Het
Tcaf3 T C 6: 42,574,014 (GRCm39) E66G probably damaging Het
Tdpoz8 A T 3: 92,981,393 (GRCm39) D137V probably damaging Het
Tmem8b A G 4: 43,673,892 (GRCm39) probably benign Het
Trpa1 T C 1: 14,963,488 (GRCm39) N578S possibly damaging Het
Vmn2r25 A T 6: 123,830,143 (GRCm39) L3I probably benign Het
Vmn2r76 T C 7: 85,875,244 (GRCm39) T578A probably benign Het
Vwa8 T A 14: 79,302,336 (GRCm39) F1002I probably damaging Het
Xdh T C 17: 74,214,653 (GRCm39) E764G probably damaging Het
Zfp518a G T 19: 40,903,754 (GRCm39) V1228F probably damaging Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23,036,160 (GRCm39) missense probably damaging 1.00
IGL02103:Mastl APN 2 23,030,010 (GRCm39) missense probably benign 0.01
IGL02622:Mastl APN 2 23,022,857 (GRCm39) missense probably benign 0.12
IGL02826:Mastl APN 2 23,035,421 (GRCm39) missense probably damaging 1.00
IGL02896:Mastl APN 2 23,021,779 (GRCm39) missense probably damaging 1.00
IGL03024:Mastl APN 2 23,029,931 (GRCm39) missense probably damaging 1.00
IGL03038:Mastl APN 2 23,030,627 (GRCm39) splice site probably benign
R0600:Mastl UTSW 2 23,023,358 (GRCm39) missense probably benign 0.06
R0712:Mastl UTSW 2 23,041,005 (GRCm39) missense probably damaging 1.00
R1168:Mastl UTSW 2 23,023,144 (GRCm39) missense probably benign 0.06
R1750:Mastl UTSW 2 23,036,093 (GRCm39) nonsense probably null
R1911:Mastl UTSW 2 23,022,692 (GRCm39) nonsense probably null
R2051:Mastl UTSW 2 23,022,836 (GRCm39) missense possibly damaging 0.49
R2859:Mastl UTSW 2 23,029,979 (GRCm39) missense probably damaging 0.99
R3840:Mastl UTSW 2 23,030,563 (GRCm39) missense probably damaging 1.00
R4807:Mastl UTSW 2 23,022,855 (GRCm39) missense probably benign
R4818:Mastl UTSW 2 23,027,038 (GRCm39) missense probably benign 0.00
R4845:Mastl UTSW 2 23,030,010 (GRCm39) missense probably benign 0.01
R5338:Mastl UTSW 2 23,023,503 (GRCm39) missense probably benign 0.01
R5364:Mastl UTSW 2 23,023,665 (GRCm39) missense probably benign 0.16
R6077:Mastl UTSW 2 23,045,806 (GRCm39) missense probably damaging 0.99
R6158:Mastl UTSW 2 23,022,784 (GRCm39) missense possibly damaging 0.92
R6450:Mastl UTSW 2 23,010,941 (GRCm39) missense probably damaging 1.00
R6602:Mastl UTSW 2 23,022,689 (GRCm39) missense probably benign 0.04
R6788:Mastl UTSW 2 23,023,710 (GRCm39) missense probably benign 0.22
R6908:Mastl UTSW 2 23,045,988 (GRCm39) start gained probably benign
R7058:Mastl UTSW 2 23,023,425 (GRCm39) nonsense probably null
R7233:Mastl UTSW 2 23,023,670 (GRCm39) missense probably benign
R7249:Mastl UTSW 2 23,036,151 (GRCm39) missense probably damaging 1.00
R7347:Mastl UTSW 2 23,023,401 (GRCm39) missense probably damaging 0.99
R7371:Mastl UTSW 2 23,030,585 (GRCm39) missense probably damaging 1.00
R7726:Mastl UTSW 2 23,030,807 (GRCm39) splice site probably null
R8057:Mastl UTSW 2 23,023,566 (GRCm39) missense possibly damaging 0.75
R8288:Mastl UTSW 2 23,023,371 (GRCm39) missense probably damaging 1.00
R9101:Mastl UTSW 2 23,008,449 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTACTAAGAGCTTCATCTTCAG -3'
(R):5'- TCCTATACCAGCCAGTTCTGTG -3'

Sequencing Primer
(F):5'- AGGCTCGGTACTTACATC -3'
(R):5'- ATACCAGCCAGTTCTGTGGGTAC -3'
Posted On 2015-03-25