Incidental Mutation 'R3799:Adgrf3'
ID272874
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Nameadhesion G protein-coupled receptor F3
SynonymsGpr113, LOC381628, PGR23
MMRRC Submission 040877-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3799 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30193431-30205722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30196823 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 736 (I736V)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088117
AA Change: I736V

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: I736V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114774
AA Change: I736V

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110422
Gene: ENSMUSG00000067642
AA Change: I736V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
Pfam:DUF3497 417 609 1.1e-12 PFAM
GPS 631 683 2.68e-17 SMART
Pfam:7tm_2 686 934 5.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A G 4: 128,767,070 T140A probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Ccna1 G T 3: 55,050,619 T155K probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Dnah12 T C 14: 26,770,923 W1214R probably damaging Het
Ehbp1l1 A G 19: 5,719,115 V720A probably benign Het
Exog T G 9: 119,449,810 N186K probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Flnc G A 6: 29,443,739 V587M probably damaging Het
Gm1527 A G 3: 28,926,596 N615S possibly damaging Het
Gm4858 A T 3: 93,074,086 D137V probably damaging Het
Gm5799 G A 14: 43,543,693 G17E probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Mastl T C 2: 23,140,492 probably benign Het
Mogat1 A G 1: 78,529,138 I216V probably benign Het
Nans A G 4: 46,492,839 E89G probably benign Het
Nuggc T A 14: 65,619,638 M396K probably benign Het
Nup214 T C 2: 32,034,682 F236S probably damaging Het
Osbp2 T C 11: 3,717,883 E145G probably damaging Het
Paqr3 T C 5: 97,111,316 N43S probably damaging Het
Pard3b A G 1: 62,161,229 N309S probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Ralgapa1 T C 12: 55,659,130 Y1869C probably damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Tcaf3 T C 6: 42,597,080 E66G probably damaging Het
Tmem8b A G 4: 43,673,892 probably benign Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Vmn2r25 A T 6: 123,853,184 L3I probably benign Het
Vmn2r76 T C 7: 86,226,036 T578A probably benign Het
Vwa8 T A 14: 79,064,896 F1002I probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1695:Adgrf3 UTSW 5 30203555 missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30197314 missense probably damaging 0.96
R6575:Adgrf3 UTSW 5 30196524 missense possibly damaging 0.72
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30199512 missense probably damaging 1.00
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGAGGACTACGTGCTTGGAC -3'
(R):5'- TTTGCCAGCATCTCACAGCC -3'

Sequencing Primer
(F):5'- CTTGGACAGCTGGTGGAAGAC -3'
(R):5'- GCCAGCATCTCACAGCCTTTTC -3'
Posted On2015-03-25