Mutagenetix > Incidental Mutation

Incidental Mutation 'R3799:Alpk3'

272880

Institutional Source

Beutler Lab

Gene Symbol

Alpk3

Ensembl Gene

ENSMUSG00000038763

Gene Name

alpha-kinase 3

Synonyms

Midori

MMRRC Submission

040877-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.459) question?

Stock #

R3799 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81057600-81105612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81092753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 773 (P773T)

Ref Sequence

ENSEMBL: ENSMUSP00000102971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107348]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000107348
AA Change: P773T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: P773T

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
IGc2	89	159	2.78e-11	SMART
low complexity region	183	192	N/A	INTRINSIC
low complexity region	400	427	N/A	INTRINSIC
low complexity region	514	532	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	958	971	N/A	INTRINSIC
low complexity region	1048	1058	N/A	INTRINSIC
low complexity region	1076	1087	N/A	INTRINSIC
IG_like	1264	1330	5.73e-2	SMART
low complexity region	1350	1359	N/A	INTRINSIC
Alpha_kinase	1395	1592	1.17e-44	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151115

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (35/36)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A3galt2	A	G	4: 128,767,070	T140A	probably damaging	Het
Adgrf3	T	C	5: 30,196,823	I736V	possibly damaging	Het
Ccna1	G	T	3: 55,050,619	T155K	probably benign	Het
Cops7a	C	T	6: 124,959,832	R252H	probably damaging	Het
Dnah12	T	C	14: 26,770,923	W1214R	probably damaging	Het
Ehbp1l1	A	G	19: 5,719,115	V720A	probably benign	Het
Exog	T	G	9: 119,449,810	N186K	probably damaging	Het
Fgfr1	G	A	8: 25,572,437	D663N	probably damaging	Het
Flnc	G	A	6: 29,443,739	V587M	probably damaging	Het
Gm1527	A	G	3: 28,926,596	N615S	possibly damaging	Het
Gm4858	A	T	3: 93,074,086	D137V	probably damaging	Het
Gm5799	G	A	14: 43,543,693	G17E	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Mastl	T	C	2: 23,140,492		probably benign	Het
Mogat1	A	G	1: 78,529,138	I216V	probably benign	Het
Nans	A	G	4: 46,492,839	E89G	probably benign	Het
Nuggc	T	A	14: 65,619,638	M396K	probably benign	Het
Nup214	T	C	2: 32,034,682	F236S	probably damaging	Het
Osbp2	T	C	11: 3,717,883	E145G	probably damaging	Het
Paqr3	T	C	5: 97,111,316	N43S	probably damaging	Het
Pard3b	A	G	1: 62,161,229	N309S	probably benign	Het
Phrf1	C	T	7: 141,259,918	R243*	probably null	Het
Ralgapa1	T	C	12: 55,659,130	Y1869C	probably damaging	Het
Setd2	T	C	9: 110,549,571	V818A	probably benign	Het
Slc35g3	A	G	11: 69,760,917	F103L	probably benign	Het
Tcaf3	T	C	6: 42,597,080	E66G	probably damaging	Het
Tmem8b	A	G	4: 43,673,892		probably benign	Het
Trpa1	T	C	1: 14,893,264	N578S	possibly damaging	Het
Vmn2r25	A	T	6: 123,853,184	L3I	probably benign	Het
Vmn2r76	T	C	7: 86,226,036	T578A	probably benign	Het
Vwa8	T	A	14: 79,064,896	F1002I	probably damaging	Het
Xdh	T	C	17: 73,907,658	E764G	probably damaging	Het
Zfp518a	G	T	19: 40,915,310	V1228F	probably damaging	Het

Other mutations in Alpk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Alpk3	APN	7	81078009	missense	possibly damaging	0.95
IGL00472:Alpk3	APN	7	81095653	splice site	probably benign
IGL01732:Alpk3	APN	7	81057642	missense	unknown
IGL01750:Alpk3	APN	7	81092282	missense	probably damaging	1.00
IGL01812:Alpk3	APN	7	81100202	missense	probably damaging	1.00
IGL02224:Alpk3	APN	7	81076868	splice site	probably benign
IGL02292:Alpk3	APN	7	81077905	missense	possibly damaging	0.46
IGL02340:Alpk3	APN	7	81078507	missense	probably benign	0.03
IGL02517:Alpk3	APN	7	81077895	missense	probably benign	0.00
IGL02725:Alpk3	APN	7	81093610	missense	possibly damaging	0.91
IGL02755:Alpk3	APN	7	81093759	missense	possibly damaging	0.71
IGL03035:Alpk3	APN	7	81078604	missense	probably benign	0.00
IGL03102:Alpk3	APN	7	81095056	critical splice donor site	probably null
IGL03153:Alpk3	APN	7	81093395	missense	probably benign	0.00
IGL03255:Alpk3	APN	7	81092562	missense	probably benign	0.01
IGL03367:Alpk3	APN	7	81094990	missense	probably benign	0.01
FR4304:Alpk3	UTSW	7	81077762	small insertion	probably benign
FR4737:Alpk3	UTSW	7	81077762	small insertion	probably benign
IGL03097:Alpk3	UTSW	7	81093909	missense	probably benign	0.00
R0092:Alpk3	UTSW	7	81092553	missense	probably benign
R0254:Alpk3	UTSW	7	81076974	missense	probably benign	0.43
R0310:Alpk3	UTSW	7	81078610	missense	possibly damaging	0.61
R0325:Alpk3	UTSW	7	81067953	missense	possibly damaging	0.58
R0387:Alpk3	UTSW	7	81104227	missense	possibly damaging	0.93
R0971:Alpk3	UTSW	7	81092579	missense	possibly damaging	0.55
R1078:Alpk3	UTSW	7	81078600	missense	probably benign
R1146:Alpk3	UTSW	7	81077595	missense	probably damaging	0.99
R1146:Alpk3	UTSW	7	81077595	missense	probably damaging	0.99
R1168:Alpk3	UTSW	7	81103357	missense	probably damaging	1.00
R1306:Alpk3	UTSW	7	81093873	missense	probably damaging	1.00
R1822:Alpk3	UTSW	7	81076931	nonsense	probably null
R2173:Alpk3	UTSW	7	81076900	missense	probably damaging	1.00
R2350:Alpk3	UTSW	7	81094970	missense	probably damaging	1.00
R2414:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R2417:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R2885:Alpk3	UTSW	7	81100192	missense	probably damaging	1.00
R3004:Alpk3	UTSW	7	81103355	nonsense	probably null
R3796:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3797:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3798:Alpk3	UTSW	7	81092753	missense	probably benign	0.02
R3894:Alpk3	UTSW	7	81078390	missense	possibly damaging	0.93
R4395:Alpk3	UTSW	7	81094955	missense	probably damaging	1.00
R4761:Alpk3	UTSW	7	81104168	missense	probably damaging	0.99
R5505:Alpk3	UTSW	7	81078561	missense	possibly damaging	0.87
R5540:Alpk3	UTSW	7	81095436	missense	probably damaging	1.00
R5770:Alpk3	UTSW	7	81078562	missense	probably benign	0.02
R5941:Alpk3	UTSW	7	81078653	missense	probably damaging	1.00
R5964:Alpk3	UTSW	7	81092260	missense	possibly damaging	0.88
R6036:Alpk3	UTSW	7	81093257	missense	probably benign	0.34
R6036:Alpk3	UTSW	7	81093257	missense	probably benign	0.34
R6066:Alpk3	UTSW	7	81076950	missense	possibly damaging	0.89
R6517:Alpk3	UTSW	7	81078579	missense	possibly damaging	0.54
R6578:Alpk3	UTSW	7	81078684	missense	probably benign	0.00
R7230:Alpk3	UTSW	7	81093294	missense	probably damaging	1.00
R7266:Alpk3	UTSW	7	81092580	missense	possibly damaging	0.55
R7271:Alpk3	UTSW	7	81078454	missense	possibly damaging	0.92
R7402:Alpk3	UTSW	7	81076912	missense	probably benign	0.29
R7411:Alpk3	UTSW	7	81092852	missense	probably benign	0.11
R7454:Alpk3	UTSW	7	81078562	missense	probably benign	0.02
R7468:Alpk3	UTSW	7	81100998	nonsense	probably null
R7940:Alpk3	UTSW	7	81093945	missense	probably damaging	1.00
R8157:Alpk3	UTSW	7	81093722	missense	probably benign	0.00
R8246:Alpk3	UTSW	7	81092776	missense	probably benign	0.00
R8357:Alpk3	UTSW	7	81093318	missense	probably damaging	1.00
R8444:Alpk3	UTSW	7	81057720	missense	probably benign	0.08
R8457:Alpk3	UTSW	7	81093318	missense	probably damaging	1.00
R8775:Alpk3	UTSW	7	81077850	missense	probably benign	0.00
R8775-TAIL:Alpk3	UTSW	7	81077850	missense	probably benign	0.00
R8794:Alpk3	UTSW	7	81057655	missense	unknown
R8982:Alpk3	UTSW	7	81099002	missense	probably damaging	1.00
R9259:Alpk3	UTSW	7	81093554	missense	probably damaging	1.00
R9343:Alpk3	UTSW	7	81092331	missense	probably benign	0.27
R9567:Alpk3	UTSW	7	81092939	missense	possibly damaging	0.55
R9792:Alpk3	UTSW	7	81101133	critical splice donor site	probably null
R9793:Alpk3	UTSW	7	81101133	critical splice donor site	probably null
R9798:Alpk3	UTSW	7	81092652	missense	probably benign	0.02
RF034:Alpk3	UTSW	7	81092414	small deletion	probably benign
RF057:Alpk3	UTSW	7	81092417	frame shift	probably null
X0022:Alpk3	UTSW	7	81093897	missense	probably damaging	0.96
Z1176:Alpk3	UTSW	7	81078626	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACAGTCAGACAGGAGTTCATGG -3'
(R):5'- TTCTTGGGGCACTGAGACAG -3'

Sequencing Primer
(F):5'- GTTCATGGAAGAATTTGGTGACAC -3'
(R):5'- GACAGGCTGTCCTCTTGC -3'

Posted On

2015-03-25