Incidental Mutation 'R3800:Ncoa3'
ID272909
Institutional Source Beutler Lab
Gene Symbol Ncoa3
Ensembl Gene ENSMUSG00000027678
Gene Namenuclear receptor coactivator 3
SynonymsTRAM-1, RAC3, AIB1, Src3, KAT13B, TRAM1, pCIP, bHLHe42, 2010305B15Rik
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165992636-166073242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 166059719 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1004 (M1004T)
Ref Sequence ENSEMBL: ENSMUSP00000104875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088095] [ENSMUST00000109252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088095
AA Change: M1004T

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: M1004T

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 1.6e-34 PFAM
Pfam:NCOA_u2 451 564 7.1e-46 PFAM
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 1.6e-32 PFAM
Pfam:DUF4927 714 801 2e-32 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1104 2.1e-27 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1221 1233 N/A INTRINSIC
low complexity region 1243 1263 N/A INTRINSIC
DUF1518 1270 1327 1.08e-21 SMART
low complexity region 1384 1398 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109252
AA Change: M1004T

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: M1004T

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 4.1e-34 PFAM
low complexity region 438 467 N/A INTRINSIC
low complexity region 502 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 3.5e-28 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1106 6.6e-29 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
low complexity region 1242 1262 N/A INTRINSIC
DUF1518 1269 1326 1.08e-21 SMART
low complexity region 1383 1397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139658
Meta Mutation Damage Score 0.2158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Ncoa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ncoa3 APN 2 166051609 splice site probably null
IGL01068:Ncoa3 APN 2 166052795 missense probably damaging 1.00
IGL01300:Ncoa3 APN 2 166068461 missense probably benign 0.41
IGL01336:Ncoa3 APN 2 166054523 missense probably benign
IGL01533:Ncoa3 APN 2 166055025 missense probably benign 0.03
IGL01658:Ncoa3 APN 2 166051302 splice site probably benign
IGL02053:Ncoa3 APN 2 166054834 missense probably damaging 1.00
IGL02138:Ncoa3 APN 2 166055262 missense probably benign
IGL02167:Ncoa3 APN 2 166070136 missense probably damaging 1.00
IGL02217:Ncoa3 APN 2 166055346 missense probably damaging 1.00
IGL02312:Ncoa3 APN 2 166057200 missense probably benign 0.10
IGL02381:Ncoa3 APN 2 166052817 missense probably damaging 1.00
IGL02568:Ncoa3 APN 2 166069357 missense probably damaging 1.00
IGL02658:Ncoa3 APN 2 166051393 missense probably benign 0.01
IGL02806:Ncoa3 APN 2 166052432 missense probably benign 0.25
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0054:Ncoa3 UTSW 2 166055178 missense possibly damaging 0.67
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0240:Ncoa3 UTSW 2 166054400 missense probably benign
R0333:Ncoa3 UTSW 2 166054291 missense probably damaging 1.00
R0379:Ncoa3 UTSW 2 166054502 missense probably damaging 0.97
R0411:Ncoa3 UTSW 2 166068543 missense probably benign 0.31
R0734:Ncoa3 UTSW 2 166069191 unclassified probably benign
R1434:Ncoa3 UTSW 2 166055510 missense probably benign 0.01
R1491:Ncoa3 UTSW 2 166055262 missense probably benign
R1721:Ncoa3 UTSW 2 166069301 missense possibly damaging 0.55
R1895:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R1896:Ncoa3 UTSW 2 166048464 missense probably benign 0.36
R1946:Ncoa3 UTSW 2 166059177 missense possibly damaging 0.68
R2406:Ncoa3 UTSW 2 166055359 missense probably damaging 1.00
R3825:Ncoa3 UTSW 2 166054798 missense possibly damaging 0.83
R4377:Ncoa3 UTSW 2 166054497 missense possibly damaging 0.50
R4674:Ncoa3 UTSW 2 166059811 missense probably benign
R4706:Ncoa3 UTSW 2 166047879 missense probably damaging 1.00
R4751:Ncoa3 UTSW 2 166069903 missense possibly damaging 0.81
R4954:Ncoa3 UTSW 2 166065786 missense probably benign
R4976:Ncoa3 UTSW 2 166047900 missense probably damaging 1.00
R4992:Ncoa3 UTSW 2 166069939 missense probably benign 0.39
R5100:Ncoa3 UTSW 2 166050097 missense probably damaging 1.00
R5578:Ncoa3 UTSW 2 166054328 missense probably benign 0.00
R5932:Ncoa3 UTSW 2 166070125 splice site probably null
R6051:Ncoa3 UTSW 2 166058765 missense probably damaging 1.00
R6370:Ncoa3 UTSW 2 166065905 missense probably benign 0.00
R6372:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R6373:Ncoa3 UTSW 2 166059347 missense possibly damaging 0.94
R7438:Ncoa3 UTSW 2 166068529 missense probably damaging 1.00
R7660:Ncoa3 UTSW 2 166069321 missense probably benign 0.00
R7738:Ncoa3 UTSW 2 166050067 missense probably damaging 1.00
R7752:Ncoa3 UTSW 2 166065768 nonsense probably null
X0018:Ncoa3 UTSW 2 166054802 missense possibly damaging 0.58
Z1177:Ncoa3 UTSW 2 166048508 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCAAATGAGTAAGCTGTCC -3'
(R):5'- ATACTCTCCCAGGGTTGCTC -3'

Sequencing Primer
(F):5'- GAAATCCCCTTTTTCGGCATAGGG -3'
(R):5'- GGTTGCTCCTGCCCACAC -3'
Posted On2015-03-25