Incidental Mutation 'R3800:Inpp5b'
ID272916
Institutional Source Beutler Lab
Gene Symbol Inpp5b
Ensembl Gene ENSMUSG00000028894
Gene Nameinositol polyphosphate-5-phosphatase B
Synonyms75kDa
MMRRC Submission 040759-MU
Accession Numbers

Ncbi RefSeq: NM_008385.3; MGI:103257

Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124741850-124801511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124785345 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 515 (T515I)
Ref Sequence ENSEMBL: ENSMUSP00000139221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094782] [ENSMUST00000184454]
Predicted Effect probably damaging
Transcript: ENSMUST00000094782
AA Change: T515I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092375
Gene: ENSMUSG00000028894
AA Change: T515I

DomainStartEndE-ValueType
Pfam:INPP5B_PH 1 150 4.3e-61 PFAM
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
Blast:RhoGAP 706 732 1e-7 BLAST
Blast:RhoGAP 755 809 2e-24 BLAST
RhoGAP 827 993 6.77e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145359
Predicted Effect probably damaging
Transcript: ENSMUST00000184454
AA Change: T515I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139221
Gene: ENSMUSG00000028894
AA Change: T515I

DomainStartEndE-ValueType
PDB:2KIG|A 1 156 1e-105 PDB
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
PDB:3QBT|H 645 782 6e-49 PDB
Meta Mutation Damage Score 0.3031 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
MGI Phenotype Strain: 2159609;2159620
FUNCTION: This gene encodes a member of the inositol polyphosphate-5-phosphatase (INPP5) family. This protein hydrolyzes the 5' phosphate from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol-1,4,5-trisphosphate, which results in changes to multiple signaling pathways. This protein may be involved in protein trafficking and secretion. Homozygous knockout mice exhibit impaired spermatogenesis and male sterility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null male mice are infertile with a disruption in spermatogenesis and a defect in adherens junctions processing. [provided by MGI curators]
Allele List at MGI

All alleles(24) : Targeted(6) Gene trapped(18)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Inpp5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Inpp5b APN 4 124784375 missense possibly damaging 0.94
IGL00696:Inpp5b APN 4 124742535 start codon destroyed probably null 1.00
IGL00969:Inpp5b APN 4 124783994 missense probably damaging 1.00
IGL01401:Inpp5b APN 4 124746087 missense probably damaging 0.97
IGL01481:Inpp5b APN 4 124800699 unclassified probably null
IGL01517:Inpp5b APN 4 124782436 missense probably benign 0.00
IGL03085:Inpp5b APN 4 124792322 missense probably benign 0.01
IGL03178:Inpp5b APN 4 124785254 missense probably benign 0.02
reduced UTSW 4 124792252 missense probably damaging 1.00
P0042:Inpp5b UTSW 4 124797910 critical splice donor site probably null
R0504:Inpp5b UTSW 4 124782408 nonsense probably null
R0531:Inpp5b UTSW 4 124795456 missense probably damaging 0.99
R1396:Inpp5b UTSW 4 124789080 missense probably damaging 1.00
R1626:Inpp5b UTSW 4 124783903 missense probably damaging 1.00
R1768:Inpp5b UTSW 4 124793276 nonsense probably null
R2037:Inpp5b UTSW 4 124798299 missense probably damaging 0.98
R2119:Inpp5b UTSW 4 124797869 missense probably benign 0.00
R2132:Inpp5b UTSW 4 124785168 splice site probably benign
R2190:Inpp5b UTSW 4 124785195 missense probably damaging 1.00
R3237:Inpp5b UTSW 4 124780486 missense probably benign 0.04
R4735:Inpp5b UTSW 4 124783967 missense probably damaging 0.99
R4827:Inpp5b UTSW 4 124743850 intron probably benign
R4865:Inpp5b UTSW 4 124751495 missense probably benign
R4868:Inpp5b UTSW 4 124751410 missense probably damaging 0.99
R4913:Inpp5b UTSW 4 124780421 missense probably benign 0.09
R5055:Inpp5b UTSW 4 124743031 critical splice donor site probably null
R5068:Inpp5b UTSW 4 124742649 intron probably null
R5208:Inpp5b UTSW 4 124751317 missense possibly damaging 0.62
R5642:Inpp5b UTSW 4 124782436 missense probably benign 0.00
R5875:Inpp5b UTSW 4 124780406 missense possibly damaging 0.66
R6015:Inpp5b UTSW 4 124798350 missense possibly damaging 0.94
R6288:Inpp5b UTSW 4 124785227 missense probably benign 0.00
R6450:Inpp5b UTSW 4 124792252 missense probably damaging 1.00
R7138:Inpp5b UTSW 4 124785272 missense probably damaging 1.00
R7235:Inpp5b UTSW 4 124751392 missense probably benign 0.04
R7382:Inpp5b UTSW 4 124751577 missense probably benign 0.00
R7659:Inpp5b UTSW 4 124795426 missense probably damaging 1.00
Z1176:Inpp5b UTSW 4 124797840 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGAAGTCCTTTCAACAGGG -3'
(R):5'- GCCCCTGATGCTCAATCAAG -3'

Sequencing Primer
(F):5'- TCCTTTCAACAGGGTAACAAAGG -3'
(R):5'- CCTGATGCTCAATCAAGACAGATTTC -3'
Posted On2015-03-25