Incidental Mutation 'R3800:Rnf34'
ID272920
Institutional Source Beutler Lab
Gene Symbol Rnf34
Ensembl Gene ENSMUSG00000029474
Gene Namering finger protein 34
Synonymsphafin 1
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122850048-122871291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122864210 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 77 (H77R)
Ref Sequence ENSEMBL: ENSMUSP00000143603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031434] [ENSMUST00000198602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031434
AA Change: H150R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031434
Gene: ENSMUSG00000029474
AA Change: H150R

DomainStartEndE-ValueType
PDB:1Y02|A 47 148 5e-21 PDB
Blast:RING 62 102 5e-17 BLAST
low complexity region 151 182 N/A INTRINSIC
low complexity region 222 246 N/A INTRINSIC
low complexity region 250 265 N/A INTRINSIC
RING 329 363 7.98e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198602
AA Change: H77R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143603
Gene: ENSMUSG00000029474
AA Change: H77R

DomainStartEndE-ValueType
Blast:RING 2 29 5e-9 BLAST
PDB:1Y02|A 2 75 2e-18 PDB
low complexity region 78 105 N/A INTRINSIC
Meta Mutation Damage Score 0.6780 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RINF finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein interacts with DNAJA3/hTid-1, which is a DnaJ protein reported to function as a modulator of apoptosis. Overexpression of this gene in Hela cells was shown to confer the resistance to TNF-alpha induced apoptosis, suggesting an anti-apoptotic function of this protein. This protein can be cleaved by caspase-3 during the induction of apoptosis. This protein also targets p53 and phospho-p53 for degradation. Alternatively splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Rnf34
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0612:Rnf34 UTSW 5 122864174 missense probably damaging 1.00
R4823:Rnf34 UTSW 5 122850302 splice site probably null
R5724:Rnf34 UTSW 5 122866889 nonsense probably null
R5881:Rnf34 UTSW 5 122864083 missense probably damaging 1.00
R6399:Rnf34 UTSW 5 122861776 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCTGTGACTGCAAGAAGG -3'
(R):5'- GTGCCAGGACTTCTGATCTG -3'

Sequencing Primer
(F):5'- GACTGCAAGAAGGATTTCTGCTCC -3'
(R):5'- ACTTCTGATCTGAAGGCGC -3'
Posted On2015-03-25