Mutagenetix > Incidental Mutation

Incidental Mutation 'R3800:Ift122'

272923

Institutional Source

Beutler Lab

Gene Symbol

Ift122

Ensembl Gene

ENSMUSG00000030323

Gene Name

intraflagellar transport 122

Synonyms

C86139, sopb, Wdr10

MMRRC Submission

040759-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3800 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

115853470-115926699 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115925906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1209 (S1209T)

Ref Sequence

ENSEMBL: ENSMUSP00000108545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]

AlphaFold

Q6NWV3

Predicted Effect

probably benign
Transcript: ENSMUST00000038234
AA Change: S1151T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: S1151T

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112923
AA Change: S1209T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: S1209T

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
Blast:WD40	163	267	3e-46	BLAST
WD40	269	308	1.91e1	SMART
WD40	310	349	3.45e-3	SMART
WD40	507	542	1.43e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112925
AA Change: S1150T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: S1150T

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124283

Predicted Effect

probably benign
Transcript: ENSMUST00000141305

SMART Domains

Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
low complexity region	124	134	N/A	INTRINSIC
low complexity region	162	176	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155565

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	G	T	14: 32,663,068	D313E	possibly damaging	Het
Abca12	C	T	1: 71,265,887	V2070I	probably damaging	Het
Adam23	C	T	1: 63,551,774	R467*	probably null	Het
Adgrf5	T	C	17: 43,447,060		probably benign	Het
Aire	A	G	10: 78,042,055		probably null	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Arhgap28	T	C	17: 67,873,036	D268G	probably damaging	Het
Btbd9	T	C	17: 30,513,659	I351V	possibly damaging	Het
Cacna1b	C	T	2: 24,658,959	R1138Q	probably benign	Het
Caskin1	T	G	17: 24,501,272	V456G	probably benign	Het
Ccdc96	A	G	5: 36,486,267	D539G	probably damaging	Het
Cep290	T	C	10: 100,572,941	I2425T	probably damaging	Het
Col18a1	C	A	10: 77,067,387	G998*	probably null	Het
Cpe	A	G	8: 64,617,617	V198A	probably benign	Het
Cux1	A	G	5: 136,316,033	M364T	probably damaging	Het
Dock8	T	A	19: 25,164,352	N1396K	probably benign	Het
Dync2h1	A	C	9: 7,101,525	F482V	possibly damaging	Het
Fat4	T	A	3: 38,981,274	V3025E	possibly damaging	Het
Fbn1	T	A	2: 125,345,974	D1545V	possibly damaging	Het
Fbxw16	T	G	9: 109,436,597	I385L	probably damaging	Het
Fnbp1	T	C	2: 31,033,131	E341G	probably damaging	Het
Gm21319	T	C	12: 87,773,721	K23E	possibly damaging	Het
Gm9845	T	C	3: 39,358,493		noncoding transcript	Het
Gmps	T	C	3: 63,982,445	Y82H	possibly damaging	Het
Habp4	C	T	13: 64,174,103	R185C	probably damaging	Het
Ino80c	T	C	18: 24,121,695	Y36C	probably damaging	Het
Inpp5b	C	T	4: 124,785,345	T515I	probably damaging	Het
Kcnj6	G	A	16: 94,833,027	T75M	probably damaging	Het
Map2k4	A	T	11: 65,690,781	Y368*	probably null	Het
Mbd6	A	G	10: 127,285,167		probably benign	Het
Mccc1	G	A	3: 36,000,509	R17W	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Ncoa3	T	C	2: 166,059,719	M1004T	possibly damaging	Het
Npnt	C	A	3: 132,906,763	G87V	probably damaging	Het
Olfr125	T	G	17: 37,835,957	N319K	probably benign	Het
Olfr17	C	T	7: 107,097,731	Q89*	probably null	Het
Ppp2r1a	A	T	17: 20,962,710	D552V	possibly damaging	Het
Prpmp5	G	A	6: 132,312,694	P56S	unknown	Het
Rnf34	A	G	5: 122,864,210	H77R	probably damaging	Het
Samm50	T	C	15: 84,192,374	V4A	probably damaging	Het
Sdccag8	A	T	1: 176,868,338	R403*	probably null	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Senp6	A	G	9: 80,087,453	R25G	possibly damaging	Het
Shc2	C	T	10: 79,626,873	V272I	probably benign	Het
Smarcd3	T	A	5: 24,593,227	K403*	probably null	Het
Srgap2	T	A	1: 131,310,559	I672F	probably damaging	Het
Ttn	C	T	2: 76,752,597	V22651I	probably damaging	Het
Ubash3a	T	C	17: 31,231,470	V373A	probably benign	Het
Vav3	A	G	3: 109,628,039	K36E	probably benign	Het
Vmn2r65	A	G	7: 84,940,530	V726A	possibly damaging	Het
Wdr66	T	C	5: 123,254,721		probably benign	Het

Other mutations in Ift122

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Ift122	APN	6	115917057	missense	probably benign	0.10
IGL00783:Ift122	APN	6	115905902	missense	probably benign
IGL00784:Ift122	APN	6	115905902	missense	probably benign
IGL00799:Ift122	APN	6	115877536	missense	probably damaging	1.00
IGL00908:Ift122	APN	6	115913909	missense	probably benign	0.00
IGL01012:Ift122	APN	6	115899491	missense	probably damaging	0.99
IGL01444:Ift122	APN	6	115884379	missense	probably benign	0.08
IGL01451:Ift122	APN	6	115912604	critical splice donor site	probably null
IGL01940:Ift122	APN	6	115887371	splice site	probably benign
IGL02089:Ift122	APN	6	115925437	missense	probably benign	0.00
IGL02331:Ift122	APN	6	115887324	missense	probably damaging	1.00
IGL02929:Ift122	APN	6	115902877	missense	probably damaging	1.00
IGL03169:Ift122	APN	6	115905961	splice site	probably benign
PIT1430001:Ift122	UTSW	6	115925744	splice site	probably benign
R0158:Ift122	UTSW	6	115924484	splice site	probably benign
R0496:Ift122	UTSW	6	115905902	missense	probably benign
R1065:Ift122	UTSW	6	115875325	splice site	probably null
R1670:Ift122	UTSW	6	115923883	missense	probably benign	0.05
R1861:Ift122	UTSW	6	115891928	missense	probably damaging	1.00
R1889:Ift122	UTSW	6	115894421	critical splice donor site	probably null
R1990:Ift122	UTSW	6	115924367	missense	probably damaging	1.00
R2362:Ift122	UTSW	6	115884350	missense	probably damaging	0.99
R2385:Ift122	UTSW	6	115912522	missense	probably benign	0.21
R3734:Ift122	UTSW	6	115925501	splice site	probably benign
R3981:Ift122	UTSW	6	115913921	missense	probably benign	0.02
R4289:Ift122	UTSW	6	115923891	missense	probably damaging	1.00
R4545:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4546:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4641:Ift122	UTSW	6	115888765	nonsense	probably null
R4815:Ift122	UTSW	6	115881556	missense	possibly damaging	0.95
R4854:Ift122	UTSW	6	115862746	missense	possibly damaging	0.61
R4928:Ift122	UTSW	6	115915858	utr 3 prime	probably benign
R5021:Ift122	UTSW	6	115864372	missense	probably benign	0.41
R5121:Ift122	UTSW	6	115912534	missense	probably benign	0.04
R5200:Ift122	UTSW	6	115920379	missense	probably damaging	0.99
R5549:Ift122	UTSW	6	115892022	missense	probably damaging	1.00
R6111:Ift122	UTSW	6	115875286	missense	probably damaging	1.00
R6141:Ift122	UTSW	6	115916011	missense	probably damaging	0.99
R6766:Ift122	UTSW	6	115926243	missense	probably benign	0.15
R7379:Ift122	UTSW	6	115926302	missense	probably benign
R7402:Ift122	UTSW	6	115894322	missense	probably benign	0.00
R7436:Ift122	UTSW	6	115926302	missense	probably benign
R7437:Ift122	UTSW	6	115926302	missense	probably benign
R7438:Ift122	UTSW	6	115926302	missense	probably benign
R7517:Ift122	UTSW	6	115890582	missense	probably benign	0.37
R7978:Ift122	UTSW	6	115920352	missense	probably benign	0.37
R8492:Ift122	UTSW	6	115887005	missense	probably benign	0.02
R8493:Ift122	UTSW	6	115910331	missense	probably benign	0.01
R8669:Ift122	UTSW	6	115923291	missense	probably damaging	0.98
R8867:Ift122	UTSW	6	115880671	missense	probably damaging	1.00
R8887:Ift122	UTSW	6	115891919	missense	probably benign	0.00
R8947:Ift122	UTSW	6	115924407	missense	probably benign
R8978:Ift122	UTSW	6	115925808	missense	possibly damaging	0.78
R9149:Ift122	UTSW	6	115890531	missense	probably damaging	1.00
R9571:Ift122	UTSW	6	115880667	missense	possibly damaging	0.50
R9573:Ift122	UTSW	6	115880685	missense	probably benign
R9677:Ift122	UTSW	6	115920396	missense	probably benign	0.16
Z1176:Ift122	UTSW	6	115915994	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATATCGCCCATGTACACC -3'
(R):5'- ACAGGTAGAGCATCCCTCACTC -3'

Sequencing Primer
(F):5'- GCCCATGTACACCTCCCC -3'
(R):5'- TGCAGAGCAGGAACCAGC -3'

Posted On

2015-03-25