Incidental Mutation 'R3800:Prpmp5'
ID272924
Institutional Source Beutler Lab
Gene Symbol Prpmp5
Ensembl Gene ENSMUSG00000107874
Gene Nameproline-rich protein MP5
SynonymsMP5
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132311590-132314757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132312694 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 56 (P56S)
Ref Sequence ENSEMBL: ENSMUSP00000047347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048686]
Predicted Effect unknown
Transcript: ENSMUST00000048686
AA Change: P56S
SMART Domains Protein: ENSMUSP00000047347
Gene: ENSMUSG00000107874
AA Change: P56S

DomainStartEndE-ValueType
Pfam:Pro-rich 1 136 2.2e-36 PFAM
Pfam:Pro-rich 84 169 6.1e-17 PFAM
Pfam:Pro-rich 131 182 2.5e-10 PFAM
Pfam:Pro-rich 171 228 4.7e-10 PFAM
Pfam:Pro-rich 222 290 1.1e-11 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Prpmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Prpmp5 APN 6 132312420 missense unknown
IGL02259:Prpmp5 APN 6 132312674 missense unknown
IGL02434:Prpmp5 APN 6 132312376 missense unknown
IGL03238:Prpmp5 APN 6 132312345 missense unknown
R0971:Prpmp5 UTSW 6 132313655 missense unknown
R1900:Prpmp5 UTSW 6 132314698 missense unknown
R3951:Prpmp5 UTSW 6 132312694 missense unknown
R3952:Prpmp5 UTSW 6 132312694 missense unknown
R3981:Prpmp5 UTSW 6 132312694 missense unknown
R4083:Prpmp5 UTSW 6 132312694 missense unknown
R4348:Prpmp5 UTSW 6 132313661 missense unknown
R4351:Prpmp5 UTSW 6 132313661 missense unknown
R4352:Prpmp5 UTSW 6 132313661 missense unknown
R4353:Prpmp5 UTSW 6 132313661 missense unknown
R6190:Prpmp5 UTSW 6 132312729 missense unknown
R7001:Prpmp5 UTSW 6 132312564 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGTTTCCAGGCCTAAGGG -3'
(R):5'- TTTTGCACAGCATTTAAGGACG -3'

Sequencing Primer
(F):5'- TAAGGGGACTCTGTGGGCC -3'
(R):5'- TGCACAGCATTTAAGGACGAATACTC -3'
Posted On2015-03-25