Incidental Mutation 'R3800:Cpe'
ID272927
Institutional Source Beutler Lab
Gene Symbol Cpe
Ensembl Gene ENSMUSG00000037852
Gene Namecarboxypeptidase E
SynonymsCph-1, CPH, carboxypeptidase H, Cph1
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location64592542-64693054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64617617 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 198 (V198A)
Ref Sequence ENSEMBL: ENSMUSP00000048555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048967]
Predicted Effect probably benign
Transcript: ENSMUST00000048967
AA Change: V198A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048555
Gene: ENSMUSG00000037852
AA Change: V198A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Zn_pept 175 465 1.85e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211312
Meta Mutation Damage Score 0.0927 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase E, a prohormone-processing exopeptidase found in secretory granules of endocrine and neuroendocrine cells. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme that cleaves the C-terminal basic residues of protein substrates. A missense mutation in this gene is responsible for the obesity phenotype in a mouse model known as the "fat mouse." Mice lacking the functional product of this gene exhibit impaired processing of multiple peptide hormones such as proinsulin, prodynorphin, proneurotensin, promelanin-concentrating hormone and pro-opiomelanocortin. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a spontaneous or a targeted null mutation display progressive obesity, abnormal blood glucose and lipid regulation, and have reduced fertility. Aberrant prohormone processing and secretion appears to be the cause of these phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Cpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Cpe APN 8 64594964 missense possibly damaging 0.46
IGL02626:Cpe APN 8 64692795 missense probably benign 0.01
R0110:Cpe UTSW 8 64611467 missense probably damaging 1.00
R0469:Cpe UTSW 8 64611467 missense probably damaging 1.00
R0510:Cpe UTSW 8 64611467 missense probably damaging 1.00
R0633:Cpe UTSW 8 64609203 missense probably damaging 1.00
R1480:Cpe UTSW 8 64594935 missense probably benign 0.00
R1738:Cpe UTSW 8 64611441 missense probably damaging 1.00
R1922:Cpe UTSW 8 64617689 missense probably benign 0.09
R2989:Cpe UTSW 8 64597515 missense probably benign 0.00
R5688:Cpe UTSW 8 64609155 missense possibly damaging 0.80
R6285:Cpe UTSW 8 64617611 missense probably benign 0.00
R6869:Cpe UTSW 8 64619427 missense probably benign 0.09
R7716:Cpe UTSW 8 64611397 missense probably damaging 1.00
R7734:Cpe UTSW 8 64617620 missense probably benign 0.30
R7740:Cpe UTSW 8 64597528 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCAGCCTTAGCCTTGAGTC -3'
(R):5'- AGCAGTACTGGGAGGATATTGC -3'

Sequencing Primer
(F):5'- CAGATCTCTGAGTTCAGTGCCAG -3'
(R):5'- GGATATTGCAATAGACAATCTCAGG -3'
Posted On2015-03-25