Incidental Mutation 'R3800:Shc2'
ID272935
Institutional Source Beutler Lab
Gene Symbol Shc2
Ensembl Gene ENSMUSG00000020312
Gene NameSHC (Src homology 2 domain containing) transforming protein 2
SynonymsShcB, Sli
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3800 (G1)
Quality Score203
Status Validated
Chromosome10
Chromosomal Location79618051-79637918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79626873 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 272 (V272I)
Ref Sequence ENSEMBL: ENSMUSP00000020564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020564]
Predicted Effect probably benign
Transcript: ENSMUST00000020564
AA Change: V272I

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020564
Gene: ENSMUSG00000020312
AA Change: V272I

DomainStartEndE-ValueType
PTB 1 154 4.43e-24 SMART
low complexity region 172 178 N/A INTRINSIC
SH2 341 420 5.81e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163867
AA Change: V272I

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129491
Gene: ENSMUSG00000020312
AA Change: V272I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
PTB 126 289 7.41e-35 SMART
low complexity region 307 313 N/A INTRINSIC
SH2 476 555 5.81e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168116
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display sensory nerve defects related to nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Shc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Shc2 APN 10 79621069 missense probably damaging 1.00
IGL01586:Shc2 APN 10 79622304 missense probably damaging 0.99
IGL01965:Shc2 APN 10 79627189 splice site probably benign
IGL02149:Shc2 APN 10 79622268 missense probably damaging 1.00
IGL02252:Shc2 APN 10 79626370 missense probably benign 0.00
shrine UTSW 10 79629917 missense probably damaging 0.99
R0538:Shc2 UTSW 10 79630140 splice site probably benign
R0630:Shc2 UTSW 10 79626141 unclassified probably null
R0894:Shc2 UTSW 10 79629917 missense probably damaging 0.99
R1166:Shc2 UTSW 10 79621112 missense probably damaging 1.00
R1339:Shc2 UTSW 10 79626416 missense probably benign 0.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1465:Shc2 UTSW 10 79631302 missense probably damaging 1.00
R1647:Shc2 UTSW 10 79626111 missense probably benign
R1648:Shc2 UTSW 10 79626111 missense probably benign
R1959:Shc2 UTSW 10 79626791 unclassified probably null
R4603:Shc2 UTSW 10 79623856 missense probably benign 0.03
R4635:Shc2 UTSW 10 79626286 missense probably benign 0.35
R4656:Shc2 UTSW 10 79621169 missense probably damaging 1.00
R4715:Shc2 UTSW 10 79622379 missense probably benign 0.01
R4841:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R4842:Shc2 UTSW 10 79622461 missense probably damaging 0.98
R5057:Shc2 UTSW 10 79623872 missense probably benign 0.01
R5394:Shc2 UTSW 10 79630099 missense probably damaging 1.00
R6153:Shc2 UTSW 10 79629918 missense possibly damaging 0.90
R6160:Shc2 UTSW 10 79627019 critical splice donor site probably null
R6178:Shc2 UTSW 10 79630120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCCTCAAGAGTACAACGG -3'
(R):5'- TCTAGGACATGACTGATTACGTG -3'

Sequencing Primer
(F):5'- CTCAAGAGTACAACGGGGCTAC -3'
(R):5'- ACATGACTGATTACGTGGCCTATG -3'
Posted On2015-03-25