Incidental Mutation 'R3800:Habp4'
ID272941
Institutional Source Beutler Lab
Gene Symbol Habp4
Ensembl Gene ENSMUSG00000021476
Gene Namehyaluronic acid binding protein 4
Synonyms
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location64161824-64186537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64174103 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 185 (R185C)
Ref Sequence ENSEMBL: ENSMUSP00000152612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021929] [ENSMUST00000221904]
Predicted Effect probably damaging
Transcript: ENSMUST00000021929
AA Change: R185C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021929
Gene: ENSMUSG00000021476
AA Change: R185C

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:IHABP4_N 16 163 2.3e-52 PFAM
low complexity region 174 201 N/A INTRINSIC
HABP4_PAI-RBP1 212 316 5.03e-34 SMART
low complexity region 365 383 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221904
AA Change: R185C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223328
Meta Mutation Damage Score 0.1061 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Habp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Habp4 APN 13 64174071 missense probably damaging 1.00
IGL02367:Habp4 APN 13 64174091 missense probably damaging 1.00
R1976:Habp4 UTSW 13 64184606 missense probably benign 0.09
R2012:Habp4 UTSW 13 64170181 splice site probably null
R2884:Habp4 UTSW 13 64182266 missense probably benign 0.40
R6404:Habp4 UTSW 13 64182186 missense possibly damaging 0.55
R7029:Habp4 UTSW 13 64162125 missense probably benign 0.08
R8025:Habp4 UTSW 13 64174831 missense probably benign 0.08
R8046:Habp4 UTSW 13 64174842 missense probably benign 0.11
RF038:Habp4 UTSW 13 64162162 small deletion probably benign
Z1177:Habp4 UTSW 13 64174068 missense probably benign 0.00
Z1177:Habp4 UTSW 13 64174070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAGTCAAGCACCATGATTTCTG -3'
(R):5'- GAATGACAGCGCACTCCTATGAAG -3'

Sequencing Primer
(F):5'- GCACCATGATTTCTGATGAACTACC -3'
(R):5'- AGCGCACTCCTATGAAGTTGGTC -3'
Posted On2015-03-25