Incidental Mutation 'R3800:3425401B19Rik'
ID272942
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32663068 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 313 (D313E)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096038
AA Change: D313E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: D313E

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226958
Meta Mutation Damage Score 0.0884 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8171:3425401B19Rik UTSW 14 32662025 missense probably benign
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32659793 missense probably damaging 0.98
R8422:3425401B19Rik UTSW 14 32662297 missense possibly damaging 0.84
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCACCTGAGGGTCAATCTGTG -3'
(R):5'- TCATTTGAGCCAAGGTATCCC -3'

Sequencing Primer
(F):5'- AGGGTCAATCTGTGAAGCATTCCC -3'
(R):5'- GAGCCAAGGTATCCCTCTCC -3'
Posted On2015-03-25