Mutagenetix > Incidental Mutations

Incidental Mutation 'R3800:Samm50'

272943

Institutional Source

Beutler Lab

Gene Symbol

Samm50

Ensembl Gene

ENSMUSG00000022437

Gene Name

SAMM50 sorting and assembly machinery component

Synonyms

1110030L07Rik

MMRRC Submission

040759-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R3800 (G1)

Quality Score

166

Status

Validated

Chromosome

Chromosomal Location

84192241-84217267 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84192374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 4 (V4A)

Ref Sequence

ENSEMBL: ENSMUSP00000023071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023071]

AlphaFold

Q8BGH2

Predicted Effect

probably damaging
Transcript: ENSMUST00000023071
AA Change: V4A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: V4A

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
Pfam:Bac_surface_Ag	151	468	1.8e-68	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230659

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231124

Meta Mutation Damage Score

0.2221

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

95% (52/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	G	T	14: 32,663,068	D313E	possibly damaging	Het
Abca12	C	T	1: 71,265,887	V2070I	probably damaging	Het
Adam23	C	T	1: 63,551,774	R467*	probably null	Het
Adgrf5	T	C	17: 43,447,060		probably benign	Het
Aire	A	G	10: 78,042,055		probably null	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Arhgap28	T	C	17: 67,873,036	D268G	probably damaging	Het
Btbd9	T	C	17: 30,513,659	I351V	possibly damaging	Het
Cacna1b	C	T	2: 24,658,959	R1138Q	probably benign	Het
Caskin1	T	G	17: 24,501,272	V456G	probably benign	Het
Ccdc96	A	G	5: 36,486,267	D539G	probably damaging	Het
Cep290	T	C	10: 100,572,941	I2425T	probably damaging	Het
Col18a1	C	A	10: 77,067,387	G998*	probably null	Het
Cpe	A	G	8: 64,617,617	V198A	probably benign	Het
Cux1	A	G	5: 136,316,033	M364T	probably damaging	Het
Dock8	T	A	19: 25,164,352	N1396K	probably benign	Het
Dync2h1	A	C	9: 7,101,525	F482V	possibly damaging	Het
Fat4	T	A	3: 38,981,274	V3025E	possibly damaging	Het
Fbn1	T	A	2: 125,345,974	D1545V	possibly damaging	Het
Fbxw16	T	G	9: 109,436,597	I385L	probably damaging	Het
Fnbp1	T	C	2: 31,033,131	E341G	probably damaging	Het
Gm21319	T	C	12: 87,773,721	K23E	possibly damaging	Het
Gm9845	T	C	3: 39,358,493		noncoding transcript	Het
Gmps	T	C	3: 63,982,445	Y82H	possibly damaging	Het
Habp4	C	T	13: 64,174,103	R185C	probably damaging	Het
Ift122	T	A	6: 115,925,906	S1209T	probably benign	Het
Ino80c	T	C	18: 24,121,695	Y36C	probably damaging	Het
Inpp5b	C	T	4: 124,785,345	T515I	probably damaging	Het
Kcnj6	G	A	16: 94,833,027	T75M	probably damaging	Het
Map2k4	A	T	11: 65,690,781	Y368*	probably null	Het
Mbd6	A	G	10: 127,285,167		probably benign	Het
Mccc1	G	A	3: 36,000,509	R17W	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Ncoa3	T	C	2: 166,059,719	M1004T	possibly damaging	Het
Npnt	C	A	3: 132,906,763	G87V	probably damaging	Het
Olfr125	T	G	17: 37,835,957	N319K	probably benign	Het
Olfr17	C	T	7: 107,097,731	Q89*	probably null	Het
Ppp2r1a	A	T	17: 20,962,710	D552V	possibly damaging	Het
Prpmp5	G	A	6: 132,312,694	P56S	unknown	Het
Rnf34	A	G	5: 122,864,210	H77R	probably damaging	Het
Sdccag8	A	T	1: 176,868,338	R403*	probably null	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Senp6	A	G	9: 80,087,453	R25G	possibly damaging	Het
Shc2	C	T	10: 79,626,873	V272I	probably benign	Het
Smarcd3	T	A	5: 24,593,227	K403*	probably null	Het
Srgap2	T	A	1: 131,310,559	I672F	probably damaging	Het
Ttn	C	T	2: 76,752,597	V22651I	probably damaging	Het
Ubash3a	T	C	17: 31,231,470	V373A	probably benign	Het
Vav3	A	G	3: 109,628,039	K36E	probably benign	Het
Vmn2r65	A	G	7: 84,940,530	V726A	possibly damaging	Het
Wdr66	T	C	5: 123,254,721		probably benign	Het

Other mutations in Samm50

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Samm50	APN	15	84200375	missense	possibly damaging	0.82
IGL01061:Samm50	APN	15	84202254	missense	probably benign	0.00
IGL01549:Samm50	APN	15	84202781	missense	probably benign
IGL01586:Samm50	APN	15	84195838	missense	probably benign	0.03
IGL02494:Samm50	APN	15	84195814	missense	probably benign
IGL02607:Samm50	APN	15	84207838	missense	probably benign	0.09
IGL03244:Samm50	APN	15	84214140	missense	probably benign	0.09
IGL03340:Samm50	APN	15	84198663	critical splice donor site	probably null
R0591:Samm50	UTSW	15	84211168	missense	probably benign
R0634:Samm50	UTSW	15	84214171	synonymous	silent
R1780:Samm50	UTSW	15	84211127	missense	probably damaging	0.99
R2192:Samm50	UTSW	15	84200424	critical splice donor site	probably null
R2205:Samm50	UTSW	15	84202314	missense	probably benign	0.01
R4285:Samm50	UTSW	15	84197012	missense	probably damaging	1.00
R4333:Samm50	UTSW	15	84202830	missense	probably benign	0.02
R4780:Samm50	UTSW	15	84210610	missense	possibly damaging	0.88
R5223:Samm50	UTSW	15	84200630	missense	probably benign	0.07
R5639:Samm50	UTSW	15	84214128	missense	probably benign	0.22
R6258:Samm50	UTSW	15	84200311	missense	probably damaging	1.00
R6258:Samm50	UTSW	15	84200312	missense	probably damaging	0.98
R6437:Samm50	UTSW	15	84204097	critical splice donor site	probably null
R6452:Samm50	UTSW	15	84204097	critical splice donor site	probably benign
R6715:Samm50	UTSW	15	84211058	missense	probably benign
R6957:Samm50	UTSW	15	84198649	missense	probably damaging	1.00
R7409:Samm50	UTSW	15	84197030	missense	probably benign	0.32
R7459:Samm50	UTSW	15	84195856	critical splice donor site	probably null
R7706:Samm50	UTSW	15	84200880	splice site	probably null
R7910:Samm50	UTSW	15	84214145	missense	possibly damaging	0.49
R8421:Samm50	UTSW	15	84210585	missense	probably benign	0.04
R8443:Samm50	UTSW	15	84210501	missense	possibly damaging	0.82
R9339:Samm50	UTSW	15	84211075	missense	probably benign	0.00
R9457:Samm50	UTSW	15	84207841	missense	probably damaging	1.00
X0067:Samm50	UTSW	15	84202833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCTGGCGTTCTTGTGAAC -3'
(R):5'- CAAGCCTTGGTGCTGTAAGGTC -3'

Sequencing Primer
(F):5'- TTGTGAACATCCGGGTCAC -3'
(R):5'- CTGTAAGGTCACCTGGGGAAATTC -3'

Posted On

2015-03-25