Incidental Mutation 'R3800:Ppp2r1a'
ID272945
Institutional Source Beutler Lab
Gene Symbol Ppp2r1a
Ensembl Gene ENSMUSG00000007564
Gene Nameprotein phosphatase 2, regulatory subunit A, alpha
SynonymsPR65, PP2A, 6330556D22Rik, protein phosphatase PP2A
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20945311-20965916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20962710 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 552 (D552V)
Ref Sequence ENSEMBL: ENSMUSP00000007708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007708] [ENSMUST00000147983] [ENSMUST00000173658]
PDB Structure
Crystal structure of a protein phosphatase 2A (PP2A) holoenzyme. [X-RAY DIFFRACTION]
Crystal structure of the full-length simian virus 40 small t antigen complexed with the protein phosphatase 2A Aalpha subunit [X-RAY DIFFRACTION]
Structural Basis of PP2A and Sgo interaction [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007708
AA Change: D552V

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007708
Gene: ENSMUSG00000007564
AA Change: D552V

DomainStartEndE-ValueType
Pfam:HEAT 166 196 4.3e-6 PFAM
Pfam:HEAT_2 170 266 1.7e-8 PFAM
Pfam:HEAT 283 313 3.4e-5 PFAM
Pfam:HEAT_2 366 467 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139293
Predicted Effect probably benign
Transcript: ENSMUST00000147983
SMART Domains Protein: ENSMUSP00000133334
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
Pfam:HEAT 13 43 2.1e-5 PFAM
Pfam:HEAT 52 82 2.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173359
Predicted Effect probably benign
Transcript: ENSMUST00000173658
SMART Domains Protein: ENSMUSP00000133778
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
PDB:2PF4|D 1 72 3e-40 PDB
SCOP:d1b3ua_ 2 86 3e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231928
Meta Mutation Damage Score 0.5981 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted allele that remove exons 5 and 6 exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased benzopyrene-induced lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Ppp2r1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp2r1a APN 17 20961578 unclassified probably benign
IGL01815:Ppp2r1a APN 17 20956832 missense probably benign 0.00
IGL01923:Ppp2r1a APN 17 20965469 makesense probably null
IGL02411:Ppp2r1a APN 17 20951334 splice site probably benign
IGL02694:Ppp2r1a APN 17 20951440 splice site probably benign
IGL02742:Ppp2r1a APN 17 20959003 missense probably benign 0.01
Dolmas UTSW 17 20960631 nonsense probably null
R0032:Ppp2r1a UTSW 17 20945584 critical splice donor site probably benign
R0403:Ppp2r1a UTSW 17 20957041 missense probably damaging 0.96
R1170:Ppp2r1a UTSW 17 20951331 splice site probably benign
R1652:Ppp2r1a UTSW 17 20955974 missense probably benign 0.03
R1857:Ppp2r1a UTSW 17 20961689 missense possibly damaging 0.93
R2215:Ppp2r1a UTSW 17 20961743 splice site probably null
R4013:Ppp2r1a UTSW 17 20951347 missense probably damaging 1.00
R4483:Ppp2r1a UTSW 17 20955810 missense probably benign 0.05
R5014:Ppp2r1a UTSW 17 20958839 splice site probably null
R5421:Ppp2r1a UTSW 17 20956706 missense probably benign
R5615:Ppp2r1a UTSW 17 20958987 missense probably benign 0.00
R5945:Ppp2r1a UTSW 17 20959413 missense possibly damaging 0.81
R5986:Ppp2r1a UTSW 17 20951346 missense probably damaging 1.00
R6466:Ppp2r1a UTSW 17 20960631 nonsense probably null
R6727:Ppp2r1a UTSW 17 20955825 missense probably benign 0.07
R6738:Ppp2r1a UTSW 17 20954717 critical splice donor site probably null
R6934:Ppp2r1a UTSW 17 20961633 missense possibly damaging 0.56
R7549:Ppp2r1a UTSW 17 20962682 missense possibly damaging 0.95
R7904:Ppp2r1a UTSW 17 20961741 critical splice donor site probably null
R7987:Ppp2r1a UTSW 17 20961741 critical splice donor site probably null
R7998:Ppp2r1a UTSW 17 20961639 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCCTTGCATAACTGTACTTCTG -3'
(R):5'- GGCAGTGCTTAATAGTTTCCCTAG -3'

Sequencing Primer
(F):5'- GCATAACTGTACTTCTGCCATTCAC -3'
(R):5'- CTGGAACTCATTCTGTAGACCAGG -3'
Posted On2015-03-25