Incidental Mutation 'R3800:Caskin1'
ID272946
Institutional Source Beutler Lab
Gene Symbol Caskin1
Ensembl Gene ENSMUSG00000033597
Gene NameCASK interacting protein 1
SynonymsC630036E02Rik, 3300002N10Rik
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R3800 (G1)
Quality Score172
Status Validated
Chromosome17
Chromosomal Location24488783-24508905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24501272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 456 (V456G)
Ref Sequence ENSEMBL: ENSMUSP00000024958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958]
Predicted Effect probably benign
Transcript: ENSMUST00000024958
AA Change: V456G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597
AA Change: V456G

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Ubash3a T C 17: 31,231,470 V373A probably benign Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Caskin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Caskin1 APN 17 24503889 missense probably damaging 1.00
IGL00846:Caskin1 APN 17 24499349 critical splice donor site probably null
IGL01120:Caskin1 APN 17 24505369 missense possibly damaging 0.56
IGL01543:Caskin1 APN 17 24504548 missense probably benign
IGL01622:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL01623:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL02120:Caskin1 APN 17 24500942 missense probably damaging 1.00
IGL02816:Caskin1 APN 17 24502170 missense probably benign 0.06
IGL02898:Caskin1 APN 17 24502409 missense probably benign 0.00
IGL03353:Caskin1 APN 17 24499357 splice site probably benign
PIT4151001:Caskin1 UTSW 17 24502219 missense probably damaging 1.00
PIT4453001:Caskin1 UTSW 17 24499292 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0190:Caskin1 UTSW 17 24504622 missense possibly damaging 0.92
R0443:Caskin1 UTSW 17 24505400 missense probably damaging 0.96
R0885:Caskin1 UTSW 17 24505694 missense probably damaging 1.00
R1035:Caskin1 UTSW 17 24505037 missense probably damaging 1.00
R1253:Caskin1 UTSW 17 24505073 missense probably damaging 1.00
R1497:Caskin1 UTSW 17 24504541 nonsense probably null
R1589:Caskin1 UTSW 17 24505478 unclassified probably null
R1651:Caskin1 UTSW 17 24502212 missense possibly damaging 0.82
R1944:Caskin1 UTSW 17 24500771 missense probably damaging 0.99
R1969:Caskin1 UTSW 17 24506850 missense possibly damaging 0.94
R2057:Caskin1 UTSW 17 24496459 missense probably damaging 0.99
R2127:Caskin1 UTSW 17 24496996 critical splice donor site probably null
R2158:Caskin1 UTSW 17 24505154 missense probably benign
R2402:Caskin1 UTSW 17 24503808 missense probably damaging 1.00
R2895:Caskin1 UTSW 17 24489042 missense probably damaging 1.00
R3423:Caskin1 UTSW 17 24499565 missense probably damaging 0.98
R4108:Caskin1 UTSW 17 24502147 missense probably benign
R4419:Caskin1 UTSW 17 24504709 missense probably damaging 1.00
R4510:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4511:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4552:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4638:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4642:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4644:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4824:Caskin1 UTSW 17 24501129 missense probably benign 0.01
R4882:Caskin1 UTSW 17 24504415 missense probably damaging 1.00
R4964:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R4966:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R5809:Caskin1 UTSW 17 24504547 missense probably benign 0.06
R5841:Caskin1 UTSW 17 24496209 missense probably damaging 0.99
R5877:Caskin1 UTSW 17 24505265 missense possibly damaging 0.69
R5960:Caskin1 UTSW 17 24498895 missense probably benign 0.31
R5994:Caskin1 UTSW 17 24496961 missense probably damaging 0.98
R6022:Caskin1 UTSW 17 24496735 missense probably benign 0.37
R6209:Caskin1 UTSW 17 24507121 missense possibly damaging 0.84
R6228:Caskin1 UTSW 17 24507180 missense probably damaging 0.99
R6287:Caskin1 UTSW 17 24496709 missense probably damaging 1.00
R6497:Caskin1 UTSW 17 24504548 missense probably benign
R6873:Caskin1 UTSW 17 24504179 missense probably benign 0.31
R7079:Caskin1 UTSW 17 24498884 missense probably benign 0.31
R7156:Caskin1 UTSW 17 24500683 splice site probably null
R7385:Caskin1 UTSW 17 24503924 missense probably damaging 1.00
X0022:Caskin1 UTSW 17 24505166 missense probably benign 0.34
X0063:Caskin1 UTSW 17 24507182 missense probably damaging 1.00
Z1176:Caskin1 UTSW 17 24505038 missense probably damaging 1.00
Z1177:Caskin1 UTSW 17 24496687 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCAGAAGTCAGTCTCTGAGTCC -3'
(R):5'- TAGCTCACAGCCTACACGATAG -3'

Sequencing Primer
(F):5'- TCTGAGTCCAGCCCAGGAGATAG -3'
(R):5'- GACAACACTTGTACACTTGTGTG -3'
Posted On2015-03-25