Incidental Mutation 'R3800:Ubash3a'
ID272948
Institutional Source Beutler Lab
Gene Symbol Ubash3a
Ensembl Gene ENSMUSG00000042345
Gene Nameubiquitin associated and SH3 domain containing, A
Synonyms5830413C03Rik, Sts-2, TULA
MMRRC Submission 040759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3800 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31207873-31242202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31231470 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 373 (V373A)
Ref Sequence ENSEMBL: ENSMUSP00000045890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048656]
PDB Structure
Crystal structure of the 2H-phosphatase domain of Sts-2 [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with tungstate. [X-RAY DIFFRACTION]
Crystal structure of the 2H-phosphatase domain of Sts-2 in complex with phosphate [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048656
AA Change: V373A

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045890
Gene: ENSMUSG00000042345
AA Change: V373A

DomainStartEndE-ValueType
Pfam:UBA 23 57 2.6e-7 PFAM
SH3 241 302 5.53e-10 SMART
Pfam:His_Phos_1 402 601 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151620
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two family members belonging to the T-cell ubiquitin ligand (TULA) family. Both family members can negatively regulate T-cell signaling. This family member can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and healthy with no abnormalities detected in any of the hematopoietic lineages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,663,068 D313E possibly damaging Het
Abca12 C T 1: 71,265,887 V2070I probably damaging Het
Adam23 C T 1: 63,551,774 R467* probably null Het
Adgrf5 T C 17: 43,447,060 probably benign Het
Aire A G 10: 78,042,055 probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap28 T C 17: 67,873,036 D268G probably damaging Het
Btbd9 T C 17: 30,513,659 I351V possibly damaging Het
Cacna1b C T 2: 24,658,959 R1138Q probably benign Het
Caskin1 T G 17: 24,501,272 V456G probably benign Het
Ccdc96 A G 5: 36,486,267 D539G probably damaging Het
Cep290 T C 10: 100,572,941 I2425T probably damaging Het
Col18a1 C A 10: 77,067,387 G998* probably null Het
Cpe A G 8: 64,617,617 V198A probably benign Het
Cux1 A G 5: 136,316,033 M364T probably damaging Het
Dock8 T A 19: 25,164,352 N1396K probably benign Het
Dync2h1 A C 9: 7,101,525 F482V possibly damaging Het
Fat4 T A 3: 38,981,274 V3025E possibly damaging Het
Fbn1 T A 2: 125,345,974 D1545V possibly damaging Het
Fbxw16 T G 9: 109,436,597 I385L probably damaging Het
Fnbp1 T C 2: 31,033,131 E341G probably damaging Het
Gm21319 T C 12: 87,773,721 K23E possibly damaging Het
Gm9845 T C 3: 39,358,493 noncoding transcript Het
Gmps T C 3: 63,982,445 Y82H possibly damaging Het
Habp4 C T 13: 64,174,103 R185C probably damaging Het
Ift122 T A 6: 115,925,906 S1209T probably benign Het
Ino80c T C 18: 24,121,695 Y36C probably damaging Het
Inpp5b C T 4: 124,785,345 T515I probably damaging Het
Kcnj6 G A 16: 94,833,027 T75M probably damaging Het
Map2k4 A T 11: 65,690,781 Y368* probably null Het
Mbd6 A G 10: 127,285,167 probably benign Het
Mccc1 G A 3: 36,000,509 R17W probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ncoa3 T C 2: 166,059,719 M1004T possibly damaging Het
Npnt C A 3: 132,906,763 G87V probably damaging Het
Olfr125 T G 17: 37,835,957 N319K probably benign Het
Olfr17 C T 7: 107,097,731 Q89* probably null Het
Ppp2r1a A T 17: 20,962,710 D552V possibly damaging Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rnf34 A G 5: 122,864,210 H77R probably damaging Het
Samm50 T C 15: 84,192,374 V4A probably damaging Het
Sdccag8 A T 1: 176,868,338 R403* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp6 A G 9: 80,087,453 R25G possibly damaging Het
Shc2 C T 10: 79,626,873 V272I probably benign Het
Smarcd3 T A 5: 24,593,227 K403* probably null Het
Srgap2 T A 1: 131,310,559 I672F probably damaging Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Vav3 A G 3: 109,628,039 K36E probably benign Het
Vmn2r65 A G 7: 84,940,530 V726A possibly damaging Het
Wdr66 T C 5: 123,254,721 probably benign Het
Other mutations in Ubash3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Ubash3a APN 17 31228186 missense probably benign
IGL01310:Ubash3a APN 17 31215142 missense probably benign 0.03
IGL01450:Ubash3a APN 17 31208231 missense probably damaging 1.00
IGL02429:Ubash3a APN 17 31241305 missense probably benign 0.00
IGL02458:Ubash3a APN 17 31231481 missense possibly damaging 0.94
IGL03014:Ubash3a UTSW 17 31239224 missense probably damaging 1.00
R1033:Ubash3a UTSW 17 31208212 missense probably damaging 1.00
R1700:Ubash3a UTSW 17 31215044 missense probably damaging 0.99
R2212:Ubash3a UTSW 17 31218034 missense probably damaging 1.00
R4125:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4127:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4128:Ubash3a UTSW 17 31237275 missense probably damaging 1.00
R4224:Ubash3a UTSW 17 31237928 missense probably damaging 1.00
R4786:Ubash3a UTSW 17 31217964 missense probably benign 0.31
R5311:Ubash3a UTSW 17 31219717 missense probably damaging 0.99
R5782:Ubash3a UTSW 17 31235503 missense probably benign 0.05
R5804:Ubash3a UTSW 17 31208232 critical splice donor site probably null
R6244:Ubash3a UTSW 17 31239272 missense possibly damaging 0.90
R6263:Ubash3a UTSW 17 31215095 missense probably benign 0.22
R6574:Ubash3a UTSW 17 31232396 missense probably damaging 1.00
R6736:Ubash3a UTSW 17 31231415 missense probably benign
R7041:Ubash3a UTSW 17 31228210 missense probably benign 0.00
R7458:Ubash3a UTSW 17 31208165 missense probably benign 0.02
R7490:Ubash3a UTSW 17 31232312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCACACTGTGACACTG -3'
(R):5'- TGGCTTAGACATGTGGACAGTG -3'

Sequencing Primer
(F):5'- ACACTGTGACACTGGCAGC -3'
(R):5'- AGACATGTGGACAGTGTGTATG -3'
Posted On2015-03-25