Mutagenetix > Incidental Mutations

Incidental Mutation 'R3801:Fap'

272958

Institutional Source

Beutler Lab

Gene Symbol

Fap

Ensembl Gene

ENSMUSG00000000392

Gene Name

fibroblast activation protein

Synonyms

MMRRC Submission

040760-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62500943-62574075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 62546650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 191 (V191I)

Ref Sequence

ENSEMBL: ENSMUSP00000000402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000173745] [ENSMUST00000174234] [ENSMUST00000174448]

AlphaFold

P97321

Predicted Effect

probably benign
Transcript: ENSMUST00000000402
AA Change: V191I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: V191I

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:DPPIV_N	73	440	2e-110	PFAM
Pfam:Abhydrolase_5	504	719	2.4e-12	PFAM
Pfam:Abhydrolase_6	515	703	2.3e-10	PFAM
Pfam:Peptidase_S9	520	727	9.4e-60	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102732
AA Change: V224I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: V224I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	106	473	1.9e-106	PFAM
Pfam:Abhydrolase_5	537	752	2.9e-12	PFAM
Pfam:Peptidase_S9	553	760	1.5e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152085

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172676

Predicted Effect

probably benign
Transcript: ENSMUST00000173745

SMART Domains

Protein: ENSMUSP00000134305
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
Pfam:DPPIV_N	12	63	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174234
AA Change: V199I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: V199I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	82	448	4.1e-108	PFAM
Pfam:Abhydrolase_5	512	727	6.4e-12	PFAM
Pfam:Abhydrolase_6	523	711	8.9e-10	PFAM
Pfam:Peptidase_S9	528	735	5.9e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174448
AA Change: V219I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: V219I

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	101	468	2.2e-110	PFAM
Pfam:Abhydrolase_5	532	747	2.5e-12	PFAM
Pfam:Abhydrolase_6	541	731	2.4e-10	PFAM
Pfam:Peptidase_S9	548	755	1e-59	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	C	T	8: 79,248,293	E54K	probably benign	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Ankfy1	T	C	11: 72,749,420	S531P	probably benign	Het
Atp6v1e1	A	G	6: 120,801,059	Y172H	probably benign	Het
Brd1	C	T	15: 88,717,040	V464M	probably damaging	Het
Btaf1	A	T	19: 36,986,548	T840S	probably benign	Het
Btaf1	A	T	19: 36,988,973	H1047L	probably benign	Het
Cacnb2	A	G	2: 14,824,263	D3G	possibly damaging	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Cgrrf1	G	T	14: 46,832,363	G30C	probably damaging	Het
Crnkl1	T	C	2: 145,919,795	D614G	probably benign	Het
Cyp2c23	C	T	19: 44,007,039	V430I	probably benign	Het
Dazl	G	A	17: 50,281,281	R289W	probably benign	Het
Dsg1b	C	T	18: 20,390,203	P96S	probably damaging	Het
Dusp14	A	G	11: 84,048,709	S169P	possibly damaging	Het
Egfem1	A	G	3: 29,151,926	D91G	probably benign	Het
Eif1	A	G	11: 100,320,824	K95E	probably damaging	Het
Flnc	T	C	6: 29,447,404	Y1069H	probably damaging	Het
Fndc7	T	C	3: 108,869,148	T526A	possibly damaging	Het
Fras1	A	T	5: 96,733,932	T2508S	probably benign	Het
Gast	T	C	11: 100,336,810	S73P	probably damaging	Het
Grap2	A	G	15: 80,623,746	T4A	possibly damaging	Het
Grm8	T	G	6: 28,125,636	N164H	possibly damaging	Het
Hyal5	A	T	6: 24,876,524	H132L	probably benign	Het
Iqcm	C	A	8: 75,669,393	T188K	possibly damaging	Het
Kank4	A	G	4: 98,780,133	S26P	probably damaging	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Lrrk2	A	G	15: 91,737,111	R963G	probably benign	Het
Lrtm2	G	A	6: 119,317,483	T229I	probably damaging	Het
Mb21d2	A	T	16: 28,828,003	D406E	possibly damaging	Het
Meikin	T	A	11: 54,399,871		probably null	Het
Mybl1	A	T	1: 9,673,214	F538I	probably damaging	Het
Nectin2	T	C	7: 19,717,636	D491G	probably benign	Het
Nf1	A	G	11: 79,559,521	D511G	probably null	Het
Nid2	T	C	14: 19,809,997	C1328R	probably damaging	Het
Nlrp1a	T	A	11: 71,122,703	M574L	probably benign	Het
Nrap	C	T	19: 56,321,779	D1595N	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1287	A	T	2: 111,449,565	I142F	probably benign	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Phkb	G	T	8: 85,922,229	E225*	probably null	Het
Plaa	T	C	4: 94,569,888	D615G	probably damaging	Het
Prdm12	A	G	2: 31,651,947	K223E	probably damaging	Het
Prkd1	C	A	12: 50,383,422	R634L	possibly damaging	Het
Rassf3	T	A	10: 121,414,366	I181F	possibly damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Sema4f	A	T	6: 82,918,627	H308Q	possibly damaging	Het
Skint4	G	T	4: 112,118,181	V113L	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slpi	A	G	2: 164,356,238	L12P	probably damaging	Het
Smco1	A	G	16: 32,273,898	Y129C	probably benign	Het
Spag17	A	G	3: 100,053,853	K985R	possibly damaging	Het
Stc1	T	C	14: 69,038,475	I239T	probably benign	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Tmed4	C	A	11: 6,274,233	V80F	probably damaging	Het
Tnpo2	T	A	8: 85,055,171		probably null	Het
Top1	A	G	2: 160,702,768	H268R	probably damaging	Het
Triobp	A	T	15: 78,973,700	Q1167L	probably benign	Het
Txndc16	G	A	14: 45,151,352	P536L	possibly damaging	Het
Usp13	C	T	3: 32,881,508	A360V	possibly damaging	Het
Vhl	G	A	6: 113,629,462	V147I	probably benign	Het
Vldlr	A	T	19: 27,217,621	T3S	probably damaging	Het
Vps54	T	A	11: 21,268,832	D130E	probably benign	Het
Zfp808	T	A	13: 62,172,083	H375Q	probably damaging	Het
Zfp87	A	T	13: 67,521,215	N37K	probably damaging	Het

Other mutations in Fap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Fap	APN	2	62524201	missense	possibly damaging	0.82
IGL01420:Fap	APN	2	62504502	splice site	probably benign
IGL01485:Fap	APN	2	62544311	missense	possibly damaging	0.80
IGL01987:Fap	APN	2	62528676	missense	probably damaging	1.00
IGL02198:Fap	APN	2	62554798	missense	probably benign
IGL02355:Fap	APN	2	62573498	missense	probably benign	0.02
IGL02362:Fap	APN	2	62573498	missense	probably benign	0.02
IGL03227:Fap	APN	2	62530763	critical splice acceptor site	probably null
IGL03266:Fap	APN	2	62537022	missense	probably benign
IGL03369:Fap	APN	2	62503355	splice site	probably benign
IGL03406:Fap	APN	2	62542122	splice site	probably benign
mnemosyne	UTSW	2	62528714	missense	probably damaging	1.00
R1467_Fap_571	UTSW	2	62517620	missense	probably benign	0.18
R4812_Fap_496	UTSW	2	62519021	missense	probably damaging	1.00
R5661_fap_070	UTSW	2	62536963	intron	probably benign
ANU74:Fap	UTSW	2	62547769	missense	probably damaging	1.00
R0254:Fap	UTSW	2	62503402	missense	probably damaging	1.00
R0842:Fap	UTSW	2	62537001	missense	probably damaging	1.00
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1591:Fap	UTSW	2	62553857	missense	probably damaging	0.99
R1671:Fap	UTSW	2	62553835	missense	possibly damaging	0.46
R1674:Fap	UTSW	2	62519005	missense	probably benign
R1795:Fap	UTSW	2	62548589	missense	probably damaging	1.00
R1869:Fap	UTSW	2	62528727	missense	probably damaging	1.00
R2032:Fap	UTSW	2	62542237	missense	probably benign	0.43
R2136:Fap	UTSW	2	62524207	missense	possibly damaging	0.94
R3546:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3547:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3771:Fap	UTSW	2	62533010	missense	probably damaging	1.00
R3910:Fap	UTSW	2	62556104	missense	probably damaging	1.00
R4306:Fap	UTSW	2	62530707	critical splice donor site	probably null
R4323:Fap	UTSW	2	62503372	missense	probably damaging	0.97
R4517:Fap	UTSW	2	62530715	missense	probably benign	0.01
R4793:Fap	UTSW	2	62544369	missense	probably damaging	1.00
R4812:Fap	UTSW	2	62519021	missense	probably damaging	1.00
R4843:Fap	UTSW	2	62544374	missense	probably damaging	1.00
R5281:Fap	UTSW	2	62532961	critical splice donor site	probably null
R5661:Fap	UTSW	2	62536963	intron	probably benign
R5696:Fap	UTSW	2	62502459	missense	probably damaging	1.00
R5750:Fap	UTSW	2	62528714	missense	probably damaging	1.00
R5898:Fap	UTSW	2	62573503	missense	probably benign
R5907:Fap	UTSW	2	62544356	missense	probably damaging	1.00
R5944:Fap	UTSW	2	62542261	missense	probably damaging	1.00
R5991:Fap	UTSW	2	62518521	missense	probably damaging	1.00
R6110:Fap	UTSW	2	62554770	missense	possibly damaging	0.91
R6270:Fap	UTSW	2	62547788	missense	probably damaging	0.98
R6505:Fap	UTSW	2	62546603	nonsense	probably null
R6631:Fap	UTSW	2	62503381	missense	probably damaging	1.00
R6896:Fap	UTSW	2	62504600	nonsense	probably null
R7138:Fap	UTSW	2	62542178	missense	probably benign	0.10
R7806:Fap	UTSW	2	62503414	missense	probably damaging	1.00
R8000:Fap	UTSW	2	62502798	critical splice donor site	probably null
R8115:Fap	UTSW	2	62519041	missense	probably benign	0.07
R8737:Fap	UTSW	2	62512433	missense	probably benign	0.00
R8899:Fap	UTSW	2	62518473	missense	probably damaging	1.00
R8924:Fap	UTSW	2	62547821	missense	probably benign
R8972:Fap	UTSW	2	62548583	missense	probably benign	0.02
R8998:Fap	UTSW	2	62537024	missense	probably benign	0.12
R8999:Fap	UTSW	2	62537024	missense	probably benign	0.12
R9418:Fap	UTSW	2	62554837	nonsense	probably null
X0017:Fap	UTSW	2	62556180	missense	probably benign	0.04
X0026:Fap	UTSW	2	62512390	missense	probably damaging	1.00
Z1176:Fap	UTSW	2	62528774	missense	possibly damaging	0.87
Z1177:Fap	UTSW	2	62502446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACATACAAGGACAAGAAGCTTTCC -3'
(R):5'- GCAGAGTATGGCATATGTTACAC -3'

Sequencing Primer
(F):5'- GACAAGAAGCTTTCCAAGTGTGTTG -3'
(R):5'- TGTTACACACACATTAAAAACA -3'

Posted On

2015-03-25