Incidental Mutation 'R3801:Olfr1287'
ID 272959
Institutional Source Beutler Lab
Gene Symbol Olfr1287
Ensembl Gene ENSMUSG00000095586
Gene Name olfactory receptor 1287
Synonyms MOR248-15, GA_x6K02T2Q125-72500603-72501520
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111449142-111450059 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111449565 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 142 (I142F)
Ref Sequence ENSEMBL: ENSMUSP00000074850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075390]
AlphaFold Q7TQY1
Predicted Effect probably benign
Transcript: ENSMUST00000075390
AA Change: I142F

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074850
Gene: ENSMUSG00000095586
AA Change: I142F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.7e-48 PFAM
Pfam:7tm_1 41 287 9.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Olfr1287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr1287 APN 2 111449889 missense probably benign 0.13
IGL01748:Olfr1287 APN 2 111449530 missense probably damaging 1.00
IGL02264:Olfr1287 APN 2 111449862 missense probably benign 0.05
IGL02371:Olfr1287 APN 2 111450009 missense probably damaging 1.00
IGL02385:Olfr1287 APN 2 111449350 missense probably damaging 1.00
IGL02704:Olfr1287 APN 2 111449147 missense probably benign 0.00
R0368:Olfr1287 UTSW 2 111449788 missense probably benign 0.07
R1520:Olfr1287 UTSW 2 111449274 missense probably benign 0.00
R2036:Olfr1287 UTSW 2 111449626 missense possibly damaging 0.80
R2890:Olfr1287 UTSW 2 111449289 missense probably benign 0.12
R3757:Olfr1287 UTSW 2 111449257 missense possibly damaging 0.95
R3958:Olfr1287 UTSW 2 111449885 missense possibly damaging 0.50
R4077:Olfr1287 UTSW 2 111449503 missense probably damaging 0.99
R4763:Olfr1287 UTSW 2 111449678 nonsense probably null
R4955:Olfr1287 UTSW 2 111449605 missense probably damaging 1.00
R4975:Olfr1287 UTSW 2 111449683 missense probably benign 0.16
R5046:Olfr1287 UTSW 2 111449589 missense probably benign 0.01
R5512:Olfr1287 UTSW 2 111449754 missense probably benign 0.00
R5708:Olfr1287 UTSW 2 111450009 missense probably damaging 1.00
R5771:Olfr1287 UTSW 2 111450061 splice site probably null
R5780:Olfr1287 UTSW 2 111449833 missense probably benign 0.03
R6981:Olfr1287 UTSW 2 111449352 missense probably benign 0.00
R7073:Olfr1287 UTSW 2 111449286 missense probably benign 0.22
R7633:Olfr1287 UTSW 2 111449622 missense probably benign
R7963:Olfr1287 UTSW 2 111449626 missense possibly damaging 0.80
R8121:Olfr1287 UTSW 2 111449160 missense probably benign 0.20
R8889:Olfr1287 UTSW 2 111449622 missense probably benign
R8892:Olfr1287 UTSW 2 111449622 missense probably benign
R9036:Olfr1287 UTSW 2 111449998 missense probably damaging 1.00
RF037:Olfr1287 UTSW 2 111449551 missense not run
RF039:Olfr1287 UTSW 2 111449551 missense not run
Z1088:Olfr1287 UTSW 2 111449457 missense probably benign 0.02
Z1176:Olfr1287 UTSW 2 111449784 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCAACCTCTTTGTTGTGATATTG -3'
(R):5'- GTTGCCAAAACACCACTGTC -3'

Sequencing Primer
(F):5'- ACCTCTTTGTTGTGATATTGATCATC -3'
(R):5'- AACACCACTGTCAGCATTTATTAG -3'
Posted On 2015-03-25