Incidental Mutation 'R3801:Top1'
ID 272961
Institutional Source Beutler Lab
Gene Symbol Top1
Ensembl Gene ENSMUSG00000070544
Gene Name topoisomerase (DNA) I
Synonyms D130064I21Rik, Top-1
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 160645888-160722764 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 160702768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 268 (H268R)
Ref Sequence ENSEMBL: ENSMUSP00000105094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109468]
AlphaFold Q04750
Predicted Effect probably damaging
Transcript: ENSMUST00000109468
AA Change: H268R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: H268R

DomainStartEndE-ValueType
low complexity region 20 95 N/A INTRINSIC
low complexity region 150 211 N/A INTRINSIC
Blast:TOPEUc 245 321 9e-19 BLAST
low complexity region 323 339 N/A INTRINSIC
TOPEUc 362 739 4.43e-280 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164510
Meta Mutation Damage Score 0.3499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Top1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Top1 APN 2 160704973 splice site probably null
IGL03083:Top1 APN 2 160703578 missense probably damaging 0.97
IGL03242:Top1 APN 2 160715733 missense probably damaging 1.00
IGL03369:Top1 APN 2 160693727 missense unknown
Mainspring UTSW 2 160714238 missense probably damaging 0.98
unwind UTSW 2 160704819 missense probably damaging 1.00
R0022:Top1 UTSW 2 160702799 missense possibly damaging 0.62
R0449:Top1 UTSW 2 160712708 nonsense probably null
R0501:Top1 UTSW 2 160714159 missense probably damaging 1.00
R0564:Top1 UTSW 2 160714265 missense probably damaging 0.98
R0946:Top1 UTSW 2 160712668 nonsense probably null
R0972:Top1 UTSW 2 160721025 missense probably damaging 1.00
R0976:Top1 UTSW 2 160717423 missense possibly damaging 0.86
R1534:Top1 UTSW 2 160714232 missense probably damaging 1.00
R1608:Top1 UTSW 2 160703595 missense probably benign 0.01
R1655:Top1 UTSW 2 160703696 critical splice donor site probably null
R1818:Top1 UTSW 2 160715723 missense probably damaging 1.00
R1937:Top1 UTSW 2 160670122 missense unknown
R2055:Top1 UTSW 2 160702828 splice site probably benign
R2104:Top1 UTSW 2 160704819 missense probably damaging 1.00
R3705:Top1 UTSW 2 160702824 critical splice donor site probably null
R3769:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3770:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3804:Top1 UTSW 2 160702768 missense probably damaging 1.00
R3928:Top1 UTSW 2 160687749 splice site probably benign
R4598:Top1 UTSW 2 160720965 missense possibly damaging 0.89
R4651:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4652:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4742:Top1 UTSW 2 160703570 critical splice acceptor site probably null
R5523:Top1 UTSW 2 160702775 nonsense probably null
R6292:Top1 UTSW 2 160698141 missense probably benign 0.19
R6724:Top1 UTSW 2 160712696 missense probably damaging 1.00
R7354:Top1 UTSW 2 160704958 missense probably damaging 1.00
R7461:Top1 UTSW 2 160712842 splice site probably null
R7843:Top1 UTSW 2 160714256 missense possibly damaging 0.90
R7855:Top1 UTSW 2 160714088 missense probably damaging 1.00
R8100:Top1 UTSW 2 160698235 nonsense probably null
R8302:Top1 UTSW 2 160703576 missense probably damaging 1.00
R8377:Top1 UTSW 2 160646089 start gained probably benign
R8380:Top1 UTSW 2 160717395 missense probably benign 0.00
R8381:Top1 UTSW 2 160703674 missense probably null 0.77
R8392:Top1 UTSW 2 160717454 nonsense probably null
R8713:Top1 UTSW 2 160717440 missense probably damaging 0.98
R8773:Top1 UTSW 2 160714238 missense probably damaging 0.98
R8844:Top1 UTSW 2 160721549 missense probably damaging 1.00
R8949:Top1 UTSW 2 160705262 missense possibly damaging 0.77
R8992:Top1 UTSW 2 160721001 missense probably damaging 0.99
R9133:Top1 UTSW 2 160703671 nonsense probably null
X0027:Top1 UTSW 2 160721518 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGACCTTTGTACACCTTG -3'
(R):5'- GCAGTCACATGAAAGCTGAG -3'

Sequencing Primer
(F):5'- GCAGACCTTTGTACACCTTGGAAAG -3'
(R):5'- AGCTGAGAAGGGATATATTCTTGTTG -3'
Posted On 2015-03-25