Mutagenetix > Incidental Mutations

Incidental Mutation 'R3801:Top1'

272961

Institutional Source

Beutler Lab

Gene Symbol

Top1

Ensembl Gene

ENSMUSG00000070544

Gene Name

topoisomerase (DNA) I

Synonyms

D130064I21Rik, Top-1

MMRRC Submission

040760-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160645888-160722764 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160702768 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 268 (H268R)

Ref Sequence

ENSEMBL: ENSMUSP00000105094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109468]

AlphaFold

Q04750

Predicted Effect

probably damaging
Transcript: ENSMUST00000109468
AA Change: H268R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: H268R

Domain	Start	End	E-Value	Type
low complexity region	20	95	N/A	INTRINSIC
low complexity region	150	211	N/A	INTRINSIC
Blast:TOPEUc	245	321	9e-19	BLAST
low complexity region	323	339	N/A	INTRINSIC
TOPEUc	362	739	4.43e-280	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164510

Meta Mutation Damage Score

0.3499

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	C	T	8: 79,248,293	E54K	probably benign	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Ankfy1	T	C	11: 72,749,420	S531P	probably benign	Het
Atp6v1e1	A	G	6: 120,801,059	Y172H	probably benign	Het
Brd1	C	T	15: 88,717,040	V464M	probably damaging	Het
Btaf1	A	T	19: 36,986,548	T840S	probably benign	Het
Btaf1	A	T	19: 36,988,973	H1047L	probably benign	Het
Cacnb2	A	G	2: 14,824,263	D3G	possibly damaging	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Cgrrf1	G	T	14: 46,832,363	G30C	probably damaging	Het
Crnkl1	T	C	2: 145,919,795	D614G	probably benign	Het
Cyp2c23	C	T	19: 44,007,039	V430I	probably benign	Het
Dazl	G	A	17: 50,281,281	R289W	probably benign	Het
Dsg1b	C	T	18: 20,390,203	P96S	probably damaging	Het
Dusp14	A	G	11: 84,048,709	S169P	possibly damaging	Het
Egfem1	A	G	3: 29,151,926	D91G	probably benign	Het
Eif1	A	G	11: 100,320,824	K95E	probably damaging	Het
Fap	C	T	2: 62,546,650	V191I	probably benign	Het
Flnc	T	C	6: 29,447,404	Y1069H	probably damaging	Het
Fndc7	T	C	3: 108,869,148	T526A	possibly damaging	Het
Fras1	A	T	5: 96,733,932	T2508S	probably benign	Het
Gast	T	C	11: 100,336,810	S73P	probably damaging	Het
Grap2	A	G	15: 80,623,746	T4A	possibly damaging	Het
Grm8	T	G	6: 28,125,636	N164H	possibly damaging	Het
Hyal5	A	T	6: 24,876,524	H132L	probably benign	Het
Iqcm	C	A	8: 75,669,393	T188K	possibly damaging	Het
Kank4	A	G	4: 98,780,133	S26P	probably damaging	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Lrrk2	A	G	15: 91,737,111	R963G	probably benign	Het
Lrtm2	G	A	6: 119,317,483	T229I	probably damaging	Het
Mb21d2	A	T	16: 28,828,003	D406E	possibly damaging	Het
Meikin	T	A	11: 54,399,871		probably null	Het
Mybl1	A	T	1: 9,673,214	F538I	probably damaging	Het
Nectin2	T	C	7: 19,717,636	D491G	probably benign	Het
Nf1	A	G	11: 79,559,521	D511G	probably null	Het
Nid2	T	C	14: 19,809,997	C1328R	probably damaging	Het
Nlrp1a	T	A	11: 71,122,703	M574L	probably benign	Het
Nrap	C	T	19: 56,321,779	D1595N	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1287	A	T	2: 111,449,565	I142F	probably benign	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Phkb	G	T	8: 85,922,229	E225*	probably null	Het
Plaa	T	C	4: 94,569,888	D615G	probably damaging	Het
Prdm12	A	G	2: 31,651,947	K223E	probably damaging	Het
Prkd1	C	A	12: 50,383,422	R634L	possibly damaging	Het
Rassf3	T	A	10: 121,414,366	I181F	possibly damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Sema4f	A	T	6: 82,918,627	H308Q	possibly damaging	Het
Skint4	G	T	4: 112,118,181	V113L	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slpi	A	G	2: 164,356,238	L12P	probably damaging	Het
Smco1	A	G	16: 32,273,898	Y129C	probably benign	Het
Spag17	A	G	3: 100,053,853	K985R	possibly damaging	Het
Stc1	T	C	14: 69,038,475	I239T	probably benign	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Tmed4	C	A	11: 6,274,233	V80F	probably damaging	Het
Tnpo2	T	A	8: 85,055,171		probably null	Het
Triobp	A	T	15: 78,973,700	Q1167L	probably benign	Het
Txndc16	G	A	14: 45,151,352	P536L	possibly damaging	Het
Usp13	C	T	3: 32,881,508	A360V	possibly damaging	Het
Vhl	G	A	6: 113,629,462	V147I	probably benign	Het
Vldlr	A	T	19: 27,217,621	T3S	probably damaging	Het
Vps54	T	A	11: 21,268,832	D130E	probably benign	Het
Zfp808	T	A	13: 62,172,083	H375Q	probably damaging	Het
Zfp87	A	T	13: 67,521,215	N37K	probably damaging	Het

Other mutations in Top1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02168:Top1	APN	2	160704973	splice site	probably null
IGL03083:Top1	APN	2	160703578	missense	probably damaging	0.97
IGL03242:Top1	APN	2	160715733	missense	probably damaging	1.00
IGL03369:Top1	APN	2	160693727	missense	unknown
Mainspring	UTSW	2	160714238	missense	probably damaging	0.98
unwind	UTSW	2	160704819	missense	probably damaging	1.00
R0022:Top1	UTSW	2	160702799	missense	possibly damaging	0.62
R0449:Top1	UTSW	2	160712708	nonsense	probably null
R0501:Top1	UTSW	2	160714159	missense	probably damaging	1.00
R0564:Top1	UTSW	2	160714265	missense	probably damaging	0.98
R0946:Top1	UTSW	2	160712668	nonsense	probably null
R0972:Top1	UTSW	2	160721025	missense	probably damaging	1.00
R0976:Top1	UTSW	2	160717423	missense	possibly damaging	0.86
R1534:Top1	UTSW	2	160714232	missense	probably damaging	1.00
R1608:Top1	UTSW	2	160703595	missense	probably benign	0.01
R1655:Top1	UTSW	2	160703696	critical splice donor site	probably null
R1818:Top1	UTSW	2	160715723	missense	probably damaging	1.00
R1937:Top1	UTSW	2	160670122	missense	unknown
R2055:Top1	UTSW	2	160702828	splice site	probably benign
R2104:Top1	UTSW	2	160704819	missense	probably damaging	1.00
R3705:Top1	UTSW	2	160702824	critical splice donor site	probably null
R3769:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3770:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3804:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3928:Top1	UTSW	2	160687749	splice site	probably benign
R4598:Top1	UTSW	2	160720965	missense	possibly damaging	0.89
R4651:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4652:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4742:Top1	UTSW	2	160703570	critical splice acceptor site	probably null
R5523:Top1	UTSW	2	160702775	nonsense	probably null
R6292:Top1	UTSW	2	160698141	missense	probably benign	0.19
R6724:Top1	UTSW	2	160712696	missense	probably damaging	1.00
R7354:Top1	UTSW	2	160704958	missense	probably damaging	1.00
R7461:Top1	UTSW	2	160712842	splice site	probably null
R7843:Top1	UTSW	2	160714256	missense	possibly damaging	0.90
R7855:Top1	UTSW	2	160714088	missense	probably damaging	1.00
R8100:Top1	UTSW	2	160698235	nonsense	probably null
R8302:Top1	UTSW	2	160703576	missense	probably damaging	1.00
R8377:Top1	UTSW	2	160646089	start gained	probably benign
R8380:Top1	UTSW	2	160717395	missense	probably benign	0.00
R8381:Top1	UTSW	2	160703674	missense	probably null	0.77
R8392:Top1	UTSW	2	160717454	nonsense	probably null
R8713:Top1	UTSW	2	160717440	missense	probably damaging	0.98
R8773:Top1	UTSW	2	160714238	missense	probably damaging	0.98
R8844:Top1	UTSW	2	160721549	missense	probably damaging	1.00
R8949:Top1	UTSW	2	160705262	missense	possibly damaging	0.77
R8992:Top1	UTSW	2	160721001	missense	probably damaging	0.99
R9133:Top1	UTSW	2	160703671	nonsense	probably null
X0027:Top1	UTSW	2	160721518	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAGACCTTTGTACACCTTG -3'
(R):5'- GCAGTCACATGAAAGCTGAG -3'

Sequencing Primer
(F):5'- GCAGACCTTTGTACACCTTGGAAAG -3'
(R):5'- AGCTGAGAAGGGATATATTCTTGTTG -3'

Posted On

2015-03-25