Incidental Mutation 'R3801:Egfem1'
ID 272963
Institutional Source Beutler Lab
Gene Symbol Egfem1
Ensembl Gene ENSMUSG00000063600
Gene Name EGF-like and EMI domain containing 1
Synonyms 6130401L20Rik
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 29082023-29691209 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29151926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000118156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118531] [ENSMUST00000119598] [ENSMUST00000124809] [ENSMUST00000146943]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118531
AA Change: D104G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112907
Gene: ENSMUSG00000063600
AA Change: D104G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 30 104 1.4e-15 PFAM
Blast:EGF_like 108 145 7e-10 BLAST
EGF 150 187 2.16e1 SMART
EGF_CA 188 228 2.66e-10 SMART
EGF 237 274 1.08e-1 SMART
EGF_like 275 313 9.19e-5 SMART
low complexity region 317 331 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
EGF 391 424 1.09e1 SMART
Blast:EGF_like 449 481 5e-10 BLAST
EGF 492 526 2.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119598
AA Change: D104G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112943
Gene: ENSMUSG00000063600
AA Change: D104G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 31 102 1.1e-15 PFAM
Blast:EGF_like 108 145 6e-10 BLAST
EGF_CA 164 204 1.61e-9 SMART
EGF 208 244 6.4e-4 SMART
EGF_CA 245 285 1.81e-12 SMART
EGF 294 331 1.08e-1 SMART
EGF_like 332 370 9.19e-5 SMART
low complexity region 374 388 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
EGF 448 481 1.09e1 SMART
Blast:EGF_like 506 538 5e-10 BLAST
EGF 549 583 2.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124809
AA Change: D83G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114314
Gene: ENSMUSG00000063600
AA Change: D83G

DomainStartEndE-ValueType
Pfam:EMI 9 83 7.7e-17 PFAM
Blast:EGF_like 87 124 6e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126420
Predicted Effect probably benign
Transcript: ENSMUST00000146943
AA Change: D91G

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118156
Gene: ENSMUSG00000063600
AA Change: D91G

DomainStartEndE-ValueType
Pfam:EMI 17 91 1.8e-16 PFAM
Blast:EGF_like 95 132 2e-11 BLAST
EGF 137 174 2.16e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Egfem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Egfem1 APN 3 29657153 missense possibly damaging 0.54
IGL02111:Egfem1 APN 3 29650896 splice site probably null
IGL02325:Egfem1 APN 3 29151917 missense probably benign 0.01
IGL02450:Egfem1 APN 3 29657268 critical splice donor site probably null
IGL02543:Egfem1 APN 3 29668380 missense probably benign 0.01
IGL02835:Egfem1 UTSW 3 29657241 missense probably damaging 1.00
P0033:Egfem1 UTSW 3 29690191 missense probably damaging 1.00
R0010:Egfem1 UTSW 3 29582919 missense probably damaging 1.00
R0294:Egfem1 UTSW 3 29690121 missense probably damaging 1.00
R0379:Egfem1 UTSW 3 29668250 missense possibly damaging 0.92
R1479:Egfem1 UTSW 3 29657165 missense probably damaging 1.00
R1572:Egfem1 UTSW 3 29648271 missense probably benign 0.02
R1754:Egfem1 UTSW 3 29668333 missense possibly damaging 0.68
R2568:Egfem1 UTSW 3 29582931 missense probably damaging 1.00
R2679:Egfem1 UTSW 3 29670676 missense probably benign 0.01
R3411:Egfem1 UTSW 3 29583021 missense probably damaging 1.00
R4049:Egfem1 UTSW 3 29686731 missense probably benign 0.01
R4851:Egfem1 UTSW 3 29151883 missense possibly damaging 0.92
R4917:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4918:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4969:Egfem1 UTSW 3 29582996 missense probably damaging 0.98
R4997:Egfem1 UTSW 3 29153590 missense probably benign 0.00
R5148:Egfem1 UTSW 3 29457823 intron probably benign
R5194:Egfem1 UTSW 3 29357196 critical splice donor site probably null
R5284:Egfem1 UTSW 3 29650787 missense possibly damaging 0.53
R5354:Egfem1 UTSW 3 29082212 critical splice donor site probably null
R5627:Egfem1 UTSW 3 29668399 nonsense probably null
R5677:Egfem1 UTSW 3 29690174 missense probably damaging 0.99
R5928:Egfem1 UTSW 3 29582928 missense possibly damaging 0.92
R5982:Egfem1 UTSW 3 29657270 splice site probably null
R6419:Egfem1 UTSW 3 29657249 missense probably damaging 1.00
R6475:Egfem1 UTSW 3 29657163 missense probably damaging 1.00
R6586:Egfem1 UTSW 3 29662411 nonsense probably null
R7046:Egfem1 UTSW 3 29082215 splice site probably null
R7079:Egfem1 UTSW 3 29153582 missense probably benign 0.00
R7308:Egfem1 UTSW 3 29151866 missense probably benign 0.09
R7362:Egfem1 UTSW 3 29151920 missense probably benign 0.01
R7684:Egfem1 UTSW 3 29690185 missense probably damaging 0.97
R7697:Egfem1 UTSW 3 29690197 critical splice donor site probably null
R7814:Egfem1 UTSW 3 29686791 missense probably damaging 1.00
R8226:Egfem1 UTSW 3 29657255 missense probably damaging 1.00
R8429:Egfem1 UTSW 3 29657268 critical splice donor site probably null
R8928:Egfem1 UTSW 3 29690412 makesense probably null
R9210:Egfem1 UTSW 3 29153594 missense probably damaging 1.00
R9227:Egfem1 UTSW 3 29357168 missense probably benign 0.03
R9230:Egfem1 UTSW 3 29357168 missense probably benign 0.03
X0028:Egfem1 UTSW 3 29657146 missense probably damaging 1.00
Z1177:Egfem1 UTSW 3 29148453 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CCTCCCAATGTATGTGGCAG -3'
(R):5'- CCATGATATGGTGAGTCATTAGGG -3'

Sequencing Primer
(F):5'- CCCAATGTATGTGGCAGGGTTTG -3'
(R):5'- AGAGCAGTGTTTCTCAACCTG -3'
Posted On 2015-03-25