Mutagenetix > Incidental Mutations

Incidental Mutation 'R3801:Spag17'

272965

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

4931427F14Rik, PF6

MMRRC Submission

040760-MU

Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99885406-100143322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100053853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 985 (K985R)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

AlphaFold

Q5S003

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164539
AA Change: K985R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: K985R

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	C	T	8: 79,248,293	E54K	probably benign	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Ankfy1	T	C	11: 72,749,420	S531P	probably benign	Het
Atp6v1e1	A	G	6: 120,801,059	Y172H	probably benign	Het
Brd1	C	T	15: 88,717,040	V464M	probably damaging	Het
Btaf1	A	T	19: 36,986,548	T840S	probably benign	Het
Btaf1	A	T	19: 36,988,973	H1047L	probably benign	Het
Cacnb2	A	G	2: 14,824,263	D3G	possibly damaging	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Cgrrf1	G	T	14: 46,832,363	G30C	probably damaging	Het
Crnkl1	T	C	2: 145,919,795	D614G	probably benign	Het
Cyp2c23	C	T	19: 44,007,039	V430I	probably benign	Het
Dazl	G	A	17: 50,281,281	R289W	probably benign	Het
Dsg1b	C	T	18: 20,390,203	P96S	probably damaging	Het
Dusp14	A	G	11: 84,048,709	S169P	possibly damaging	Het
Egfem1	A	G	3: 29,151,926	D91G	probably benign	Het
Eif1	A	G	11: 100,320,824	K95E	probably damaging	Het
Fap	C	T	2: 62,546,650	V191I	probably benign	Het
Flnc	T	C	6: 29,447,404	Y1069H	probably damaging	Het
Fndc7	T	C	3: 108,869,148	T526A	possibly damaging	Het
Fras1	A	T	5: 96,733,932	T2508S	probably benign	Het
Gast	T	C	11: 100,336,810	S73P	probably damaging	Het
Grap2	A	G	15: 80,623,746	T4A	possibly damaging	Het
Grm8	T	G	6: 28,125,636	N164H	possibly damaging	Het
Hyal5	A	T	6: 24,876,524	H132L	probably benign	Het
Iqcm	C	A	8: 75,669,393	T188K	possibly damaging	Het
Kank4	A	G	4: 98,780,133	S26P	probably damaging	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Lrrk2	A	G	15: 91,737,111	R963G	probably benign	Het
Lrtm2	G	A	6: 119,317,483	T229I	probably damaging	Het
Mb21d2	A	T	16: 28,828,003	D406E	possibly damaging	Het
Meikin	T	A	11: 54,399,871		probably null	Het
Mybl1	A	T	1: 9,673,214	F538I	probably damaging	Het
Nectin2	T	C	7: 19,717,636	D491G	probably benign	Het
Nf1	A	G	11: 79,559,521	D511G	probably null	Het
Nid2	T	C	14: 19,809,997	C1328R	probably damaging	Het
Nlrp1a	T	A	11: 71,122,703	M574L	probably benign	Het
Nrap	C	T	19: 56,321,779	D1595N	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1287	A	T	2: 111,449,565	I142F	probably benign	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Phkb	G	T	8: 85,922,229	E225*	probably null	Het
Plaa	T	C	4: 94,569,888	D615G	probably damaging	Het
Prdm12	A	G	2: 31,651,947	K223E	probably damaging	Het
Prkd1	C	A	12: 50,383,422	R634L	possibly damaging	Het
Rassf3	T	A	10: 121,414,366	I181F	possibly damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Sema4f	A	T	6: 82,918,627	H308Q	possibly damaging	Het
Skint4	G	T	4: 112,118,181	V113L	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slpi	A	G	2: 164,356,238	L12P	probably damaging	Het
Smco1	A	G	16: 32,273,898	Y129C	probably benign	Het
Stc1	T	C	14: 69,038,475	I239T	probably benign	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Tmed4	C	A	11: 6,274,233	V80F	probably damaging	Het
Tnpo2	T	A	8: 85,055,171		probably null	Het
Top1	A	G	2: 160,702,768	H268R	probably damaging	Het
Triobp	A	T	15: 78,973,700	Q1167L	probably benign	Het
Txndc16	G	A	14: 45,151,352	P536L	possibly damaging	Het
Usp13	C	T	3: 32,881,508	A360V	possibly damaging	Het
Vhl	G	A	6: 113,629,462	V147I	probably benign	Het
Vldlr	A	T	19: 27,217,621	T3S	probably damaging	Het
Vps54	T	A	11: 21,268,832	D130E	probably benign	Het
Zfp808	T	A	13: 62,172,083	H375Q	probably damaging	Het
Zfp87	A	T	13: 67,521,215	N37K	probably damaging	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	100063375	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99939298	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100095549	missense	probably benign	0.16
IGL01393:Spag17	APN	3	100027610	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100109508	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	100022730	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99940074	splice site	probably benign
IGL01981:Spag17	APN	3	100058833	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99982444	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	100027391	missense	probably benign	0.00
IGL02465:Spag17	APN	3	100075871	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	100072085	missense	probably benign	0.09
IGL02751:Spag17	APN	3	100010794	nonsense	probably null
IGL02803:Spag17	APN	3	100109397	missense	probably benign
IGL02898:Spag17	APN	3	100101386	missense	probably benign	0.00
IGL03037:Spag17	APN	3	100072170	splice site	probably null
IGL03068:Spag17	APN	3	100080205	missense	probably benign	0.35
IGL03131:Spag17	APN	3	100010759	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	100010840	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	100056249	small insertion	probably benign
FR4342:Spag17	UTSW	3	100056252	small insertion	probably benign
FR4548:Spag17	UTSW	3	100056254	small insertion	probably benign
FR4589:Spag17	UTSW	3	100056245	small insertion	probably benign
FR4589:Spag17	UTSW	3	100056258	small insertion	probably benign
FR4737:Spag17	UTSW	3	100056257	small insertion	probably benign
FR4976:Spag17	UTSW	3	100056254	small insertion	probably benign
FR4976:Spag17	UTSW	3	100056255	small insertion	probably benign
N/A:Spag17	UTSW	3	99982254	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100103110	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	100013211	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	100050787	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100106827	missense	probably benign	0.08
R0243:Spag17	UTSW	3	100085368	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100101403	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	100027590	missense	probably benign
R0417:Spag17	UTSW	3	100065554	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99982411	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100125302	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	100080156	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	100004785	missense	probably benign
R0919:Spag17	UTSW	3	100071943	splice site	probably benign
R0926:Spag17	UTSW	3	100072116	missense	probably benign
R1037:Spag17	UTSW	3	100103117	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100093676	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	100027351	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100095638	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99982268	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99939363	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	100021752	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	100027352	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	100010754	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99939356	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99939982	missense	probably benign
R2065:Spag17	UTSW	3	100013208	missense	probably benign	0.03
R2118:Spag17	UTSW	3	100049240	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	100061866	splice site	probably null
R2266:Spag17	UTSW	3	100061866	splice site	probably null
R2267:Spag17	UTSW	3	100061866	splice site	probably null
R2268:Spag17	UTSW	3	100061866	splice site	probably null
R2271:Spag17	UTSW	3	100106797	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100106837	missense	probably benign	0.27
R2420:Spag17	UTSW	3	100027619	missense	probably benign
R2422:Spag17	UTSW	3	100027619	missense	probably benign
R2423:Spag17	UTSW	3	100103456	missense	probably benign
R3407:Spag17	UTSW	3	100085299	missense	probably benign	0.09
R3856:Spag17	UTSW	3	100106759	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	100049230	missense	probably benign	0.00
R4022:Spag17	UTSW	3	100049230	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100103378	missense	probably benign
R4468:Spag17	UTSW	3	100085366	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	100088381	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100103243	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100103243	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100103385	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99984479	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	100063333	missense	probably benign	0.02
R4887:Spag17	UTSW	3	100050831	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	100027623	missense	probably benign
R5030:Spag17	UTSW	3	100085341	nonsense	probably null
R5042:Spag17	UTSW	3	100072149	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	100080118	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100101388	missense	probably benign	0.16
R5200:Spag17	UTSW	3	100063471	nonsense	probably null
R5267:Spag17	UTSW	3	100061948	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100109410	missense	probably benign	0.00
R5444:Spag17	UTSW	3	100056152	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100103345	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	100027244	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	100056272	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	100056152	missense	probably benign	0.06
R5575:Spag17	UTSW	3	100053822	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	100080119	missense	probably benign	0.33
R5639:Spag17	UTSW	3	100056166	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99939250	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100095791	nonsense	probably null
R6082:Spag17	UTSW	3	100124185	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	100022602	missense	probably benign	0.33
R6254:Spag17	UTSW	3	100065585	missense	probably benign	0.03
R6321:Spag17	UTSW	3	100088427	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100103132	missense	probably benign
R6687:Spag17	UTSW	3	100092950	missense	probably benign	0.07
R6853:Spag17	UTSW	3	100013235	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	100004683	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	100034975	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99984609	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99939270	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100101435	missense	probably benign	0.00
R7144:Spag17	UTSW	3	100027401	splice site	probably null
R7198:Spag17	UTSW	3	100095572	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99939983	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99939375	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	100027231	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	100034159	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99939247	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100095595	nonsense	probably null
R7772:Spag17	UTSW	3	100080118	missense	probably damaging	0.98
R7842:Spag17	UTSW	3	100053858	missense	probably benign	0.18
R7963:Spag17	UTSW	3	100022638	missense	probably benign	0.02
R8168:Spag17	UTSW	3	100034984	missense	possibly damaging	0.96
R8291:Spag17	UTSW	3	100060850	missense	probably benign
R8347:Spag17	UTSW	3	100027641	missense	probably benign
R8383:Spag17	UTSW	3	100085392	missense	probably damaging	0.98
R8474:Spag17	UTSW	3	100027270	missense	probably benign	0.00
R8528:Spag17	UTSW	3	100124185	missense	possibly damaging	0.46
R8804:Spag17	UTSW	3	99967190	missense	probably benign
R8809:Spag17	UTSW	3	99982422	missense	probably benign	0.33
R8818:Spag17	UTSW	3	100013227	missense	probably benign	0.02
R8830:Spag17	UTSW	3	100125435	missense	possibly damaging	0.77
R8890:Spag17	UTSW	3	100004678	missense	possibly damaging	0.73
R9008:Spag17	UTSW	3	100027626	missense	possibly damaging	0.73
R9095:Spag17	UTSW	3	100004776	missense	possibly damaging	0.86
R9143:Spag17	UTSW	3	100027590	missense	probably benign
R9182:Spag17	UTSW	3	100058842	missense	possibly damaging	0.92
R9211:Spag17	UTSW	3	100125298	critical splice acceptor site	probably benign
R9344:Spag17	UTSW	3	100103477	missense	probably benign	0.01
R9354:Spag17	UTSW	3	100027589	missense	probably benign
X0025:Spag17	UTSW	3	100101451	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100095630	missense	probably benign	0.09
Z1176:Spag17	UTSW	3	100012993	missense	probably benign	0.18
Z1177:Spag17	UTSW	3	100088399	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTGCTAAGCTGTTTGATG -3'
(R):5'- GGTGTTTAGCTATGAAGAAGAGTC -3'

Sequencing Primer
(F):5'- AAGCTGTTTGATGTATCCCCAG -3'
(R):5'- TTAGCTATGAAGAAGAGTCTAGACAG -3'

Posted On

2015-03-25