Mutagenetix > Incidental Mutations

Incidental Mutation 'R3801:Hyal5'

272973

Institutional Source

Beutler Lab

Gene Symbol

Hyal5

Ensembl Gene

ENSMUSG00000029678

Gene Name

hyaluronoglucosaminidase 5

Synonyms

MMRRC Submission

040760-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R3801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24857997-24891958 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24876524 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 132 (H132L)

Ref Sequence

ENSEMBL: ENSMUSP00000144011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031689] [ENSMUST00000200968]

Predicted Effect

probably benign
Transcript: ENSMUST00000031689
AA Change: H132L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031689
Gene: ENSMUSG00000029678
AA Change: H132L

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_56	42	373	2.6e-142	PFAM
Blast:EGF	375	438	3e-14	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000200968
AA Change: H132L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000144011
Gene: ENSMUSG00000029678
AA Change: H132L

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_56	42	373	2.6e-142	PFAM
Blast:EGF	375	438	3e-14	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Reproduction is normal in mice with null mutations at this marker. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	C	T	8: 79,248,293	E54K	probably benign	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Ankfy1	T	C	11: 72,749,420	S531P	probably benign	Het
Atp6v1e1	A	G	6: 120,801,059	Y172H	probably benign	Het
Brd1	C	T	15: 88,717,040	V464M	probably damaging	Het
Btaf1	A	T	19: 36,986,548	T840S	probably benign	Het
Btaf1	A	T	19: 36,988,973	H1047L	probably benign	Het
Cacnb2	A	G	2: 14,824,263	D3G	possibly damaging	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Cgrrf1	G	T	14: 46,832,363	G30C	probably damaging	Het
Crnkl1	T	C	2: 145,919,795	D614G	probably benign	Het
Cyp2c23	C	T	19: 44,007,039	V430I	probably benign	Het
Dazl	G	A	17: 50,281,281	R289W	probably benign	Het
Dsg1b	C	T	18: 20,390,203	P96S	probably damaging	Het
Dusp14	A	G	11: 84,048,709	S169P	possibly damaging	Het
Egfem1	A	G	3: 29,151,926	D91G	probably benign	Het
Eif1	A	G	11: 100,320,824	K95E	probably damaging	Het
Fap	C	T	2: 62,546,650	V191I	probably benign	Het
Flnc	T	C	6: 29,447,404	Y1069H	probably damaging	Het
Fndc7	T	C	3: 108,869,148	T526A	possibly damaging	Het
Fras1	A	T	5: 96,733,932	T2508S	probably benign	Het
Gast	T	C	11: 100,336,810	S73P	probably damaging	Het
Grap2	A	G	15: 80,623,746	T4A	possibly damaging	Het
Grm8	T	G	6: 28,125,636	N164H	possibly damaging	Het
Iqcm	C	A	8: 75,669,393	T188K	possibly damaging	Het
Kank4	A	G	4: 98,780,133	S26P	probably damaging	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Lrrk2	A	G	15: 91,737,111	R963G	probably benign	Het
Lrtm2	G	A	6: 119,317,483	T229I	probably damaging	Het
Mb21d2	A	T	16: 28,828,003	D406E	possibly damaging	Het
Meikin	T	A	11: 54,399,871		probably null	Het
Mybl1	A	T	1: 9,673,214	F538I	probably damaging	Het
Nectin2	T	C	7: 19,717,636	D491G	probably benign	Het
Nf1	A	G	11: 79,559,521	D511G	probably null	Het
Nid2	T	C	14: 19,809,997	C1328R	probably damaging	Het
Nlrp1a	T	A	11: 71,122,703	M574L	probably benign	Het
Nrap	C	T	19: 56,321,779	D1595N	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1287	A	T	2: 111,449,565	I142F	probably benign	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Phkb	G	T	8: 85,922,229	E225*	probably null	Het
Plaa	T	C	4: 94,569,888	D615G	probably damaging	Het
Prdm12	A	G	2: 31,651,947	K223E	probably damaging	Het
Prkd1	C	A	12: 50,383,422	R634L	possibly damaging	Het
Rassf3	T	A	10: 121,414,366	I181F	possibly damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Sema4f	A	T	6: 82,918,627	H308Q	possibly damaging	Het
Skint4	G	T	4: 112,118,181	V113L	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slpi	A	G	2: 164,356,238	L12P	probably damaging	Het
Smco1	A	G	16: 32,273,898	Y129C	probably benign	Het
Spag17	A	G	3: 100,053,853	K985R	possibly damaging	Het
Stc1	T	C	14: 69,038,475	I239T	probably benign	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Tmed4	C	A	11: 6,274,233	V80F	probably damaging	Het
Tnpo2	T	A	8: 85,055,171		probably null	Het
Top1	A	G	2: 160,702,768	H268R	probably damaging	Het
Triobp	A	T	15: 78,973,700	Q1167L	probably benign	Het
Txndc16	G	A	14: 45,151,352	P536L	possibly damaging	Het
Usp13	C	T	3: 32,881,508	A360V	possibly damaging	Het
Vhl	G	A	6: 113,629,462	V147I	probably benign	Het
Vldlr	A	T	19: 27,217,621	T3S	probably damaging	Het
Vps54	T	A	11: 21,268,832	D130E	probably benign	Het
Zfp808	T	A	13: 62,172,083	H375Q	probably damaging	Het
Zfp87	A	T	13: 67,521,215	N37K	probably damaging	Het

Other mutations in Hyal5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01160:Hyal5	APN	6	24876481	missense	possibly damaging	0.92
IGL01407:Hyal5	APN	6	24876407	missense	probably benign	0.08
IGL01799:Hyal5	APN	6	24891337	missense	probably benign	0.09
IGL02070:Hyal5	APN	6	24876962	missense	probably damaging	1.00
IGL02087:Hyal5	APN	6	24876725	missense	probably damaging	1.00
IGL02188:Hyal5	APN	6	24877036	missense	probably damaging	1.00
IGL02321:Hyal5	APN	6	24891615	missense	probably benign	0.01
IGL02975:Hyal5	APN	6	24891452	missense	probably benign	0.41
IGL03299:Hyal5	APN	6	24877882	missense	probably damaging	1.00
R0239:Hyal5	UTSW	6	24876344	missense	probably damaging	1.00
R0239:Hyal5	UTSW	6	24876344	missense	probably damaging	1.00
R0499:Hyal5	UTSW	6	24877921	missense	probably damaging	1.00
R1491:Hyal5	UTSW	6	24877903	missense	probably benign	0.00
R1575:Hyal5	UTSW	6	24876793	missense	probably damaging	1.00
R1967:Hyal5	UTSW	6	24876194	missense	possibly damaging	0.68
R2182:Hyal5	UTSW	6	24877880	missense	probably damaging	1.00
R3877:Hyal5	UTSW	6	24876631	missense	probably damaging	1.00
R4642:Hyal5	UTSW	6	24876622	missense	probably benign	0.01
R4826:Hyal5	UTSW	6	24891576	missense	possibly damaging	0.82
R5058:Hyal5	UTSW	6	24891485	missense	probably damaging	1.00
R5161:Hyal5	UTSW	6	24891603	missense	probably benign	0.00
R5249:Hyal5	UTSW	6	24876649	nonsense	probably null
R5459:Hyal5	UTSW	6	24891251	missense	probably damaging	0.98
R5685:Hyal5	UTSW	6	24876692	missense	probably benign	0.39
R5741:Hyal5	UTSW	6	24876495	missense	probably damaging	1.00
R5849:Hyal5	UTSW	6	24891556	missense	probably benign	0.00
R6156:Hyal5	UTSW	6	24891438	missense	possibly damaging	0.92
R6351:Hyal5	UTSW	6	24891709	unclassified	probably null
R6573:Hyal5	UTSW	6	24891552	missense	probably damaging	0.96
R6949:Hyal5	UTSW	6	24876304	missense	probably benign	0.00
R6966:Hyal5	UTSW	6	24891292	missense	probably damaging	1.00
R7148:Hyal5	UTSW	6	24876902	missense	probably damaging	1.00
R7422:Hyal5	UTSW	6	24875984	start gained	probably benign
R7836:Hyal5	UTSW	6	24891348	missense	probably damaging	1.00
R7919:Hyal5	UTSW	6	24891348	missense	probably damaging	1.00
R8062:Hyal5	UTSW	6	24876197	missense	possibly damaging	0.73
X0061:Hyal5	UTSW	6	24876973	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GAATGCCCCAACTGAGTCTTG -3'
(R):5'- TTCTTTGGCCCACTTGACAG -3'

Sequencing Primer
(F):5'- AATCAGCCACTAGATCTTGGTCTG -3'
(R):5'- GGCCCACTTGACAGCTTCTG -3'

Posted On

2015-03-25