Mutagenetix > Incidental Mutation

Incidental Mutation 'R3801:Grm8'

272974

Institutional Source

Beutler Lab

Gene Symbol

Grm8

Ensembl Gene

ENSMUSG00000024211

Gene Name

glutamate receptor, metabotropic 8

Synonyms

mGluR8, Gprc1h

MMRRC Submission

040760-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27275119-28135178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 28125636 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 164 (N164H)

Ref Sequence

ENSEMBL: ENSMUSP00000120394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897] [ENSMUST00000132755]

AlphaFold

P47743

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090512
AA Change: N164H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: N164H

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	9.6e-102	PFAM
Pfam:Peripla_BP_6	141	375	1.3e-9	PFAM
Pfam:NCD3G	512	562	5e-17	PFAM
Pfam:7tm_3	593	841	4.7e-88	PFAM
low complexity region	887	905	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115323
AA Change: N164H

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: N164H

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	3.3e-107	PFAM
Pfam:NCD3G	512	562	9e-14	PFAM
Pfam:7tm_3	595	840	6.8e-58	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115324
AA Change: N164H

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: N164H

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	2.1e-101	PFAM
Pfam:Peripla_BP_6	141	375	9.2e-10	PFAM
Pfam:NCD3G	512	562	2.8e-16	PFAM
Pfam:7tm_3	593	841	2.4e-87	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131897
AA Change: N164H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211
AA Change: N164H

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	294	5.8e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146727

Meta Mutation Damage Score

0.2839

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	C	T	8: 79,248,293	E54K	probably benign	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Ankfy1	T	C	11: 72,749,420	S531P	probably benign	Het
Atp6v1e1	A	G	6: 120,801,059	Y172H	probably benign	Het
Brd1	C	T	15: 88,717,040	V464M	probably damaging	Het
Btaf1	A	T	19: 36,986,548	T840S	probably benign	Het
Btaf1	A	T	19: 36,988,973	H1047L	probably benign	Het
Cacnb2	A	G	2: 14,824,263	D3G	possibly damaging	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Cgrrf1	G	T	14: 46,832,363	G30C	probably damaging	Het
Crnkl1	T	C	2: 145,919,795	D614G	probably benign	Het
Cyp2c23	C	T	19: 44,007,039	V430I	probably benign	Het
Dazl	G	A	17: 50,281,281	R289W	probably benign	Het
Dsg1b	C	T	18: 20,390,203	P96S	probably damaging	Het
Dusp14	A	G	11: 84,048,709	S169P	possibly damaging	Het
Egfem1	A	G	3: 29,151,926	D91G	probably benign	Het
Eif1	A	G	11: 100,320,824	K95E	probably damaging	Het
Fap	C	T	2: 62,546,650	V191I	probably benign	Het
Flnc	T	C	6: 29,447,404	Y1069H	probably damaging	Het
Fndc7	T	C	3: 108,869,148	T526A	possibly damaging	Het
Fras1	A	T	5: 96,733,932	T2508S	probably benign	Het
Gast	T	C	11: 100,336,810	S73P	probably damaging	Het
Grap2	A	G	15: 80,623,746	T4A	possibly damaging	Het
Hyal5	A	T	6: 24,876,524	H132L	probably benign	Het
Iqcm	C	A	8: 75,669,393	T188K	possibly damaging	Het
Kank4	A	G	4: 98,780,133	S26P	probably damaging	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Lrrk2	A	G	15: 91,737,111	R963G	probably benign	Het
Lrtm2	G	A	6: 119,317,483	T229I	probably damaging	Het
Mb21d2	A	T	16: 28,828,003	D406E	possibly damaging	Het
Meikin	T	A	11: 54,399,871		probably null	Het
Mybl1	A	T	1: 9,673,214	F538I	probably damaging	Het
Nectin2	T	C	7: 19,717,636	D491G	probably benign	Het
Nf1	A	G	11: 79,559,521	D511G	probably null	Het
Nid2	T	C	14: 19,809,997	C1328R	probably damaging	Het
Nlrp1a	T	A	11: 71,122,703	M574L	probably benign	Het
Nrap	C	T	19: 56,321,779	D1595N	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1287	A	T	2: 111,449,565	I142F	probably benign	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Phkb	G	T	8: 85,922,229	E225*	probably null	Het
Plaa	T	C	4: 94,569,888	D615G	probably damaging	Het
Prdm12	A	G	2: 31,651,947	K223E	probably damaging	Het
Prkd1	C	A	12: 50,383,422	R634L	possibly damaging	Het
Rassf3	T	A	10: 121,414,366	I181F	possibly damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Sema4f	A	T	6: 82,918,627	H308Q	possibly damaging	Het
Skint4	G	T	4: 112,118,181	V113L	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slpi	A	G	2: 164,356,238	L12P	probably damaging	Het
Smco1	A	G	16: 32,273,898	Y129C	probably benign	Het
Spag17	A	G	3: 100,053,853	K985R	possibly damaging	Het
Stc1	T	C	14: 69,038,475	I239T	probably benign	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Tmed4	C	A	11: 6,274,233	V80F	probably damaging	Het
Tnpo2	T	A	8: 85,055,171		probably null	Het
Top1	A	G	2: 160,702,768	H268R	probably damaging	Het
Triobp	A	T	15: 78,973,700	Q1167L	probably benign	Het
Txndc16	G	A	14: 45,151,352	P536L	possibly damaging	Het
Usp13	C	T	3: 32,881,508	A360V	possibly damaging	Het
Vhl	G	A	6: 113,629,462	V147I	probably benign	Het
Vldlr	A	T	19: 27,217,621	T3S	probably damaging	Het
Vps54	T	A	11: 21,268,832	D130E	probably benign	Het
Zfp808	T	A	13: 62,172,083	H375Q	probably damaging	Het
Zfp87	A	T	13: 67,521,215	N37K	probably damaging	Het

Other mutations in Grm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Grm8	APN	6	27363801	missense	probably damaging	1.00
IGL01412:Grm8	APN	6	27762461	missense	probably damaging	1.00
IGL02329:Grm8	APN	6	27363116	missense	probably damaging	1.00
IGL02342:Grm8	APN	6	27363804	missense	probably benign	0.00
IGL02584:Grm8	APN	6	27762439	missense	probably benign	0.35
IGL03040:Grm8	APN	6	28126123	start codon destroyed	probably null	0.01
IGL03112:Grm8	APN	6	27363263	missense	probably damaging	1.00
IGL03139:Grm8	APN	6	27618650	missense	probably damaging	1.00
IGL03287:Grm8	APN	6	27760255	missense	possibly damaging	0.86
R0137:Grm8	UTSW	6	27762390	missense	probably damaging	0.99
R0266:Grm8	UTSW	6	27285896	missense	probably damaging	1.00
R0347:Grm8	UTSW	6	27981222	missense	probably benign	0.37
R0580:Grm8	UTSW	6	27761371	splice site	probably benign
R0698:Grm8	UTSW	6	27363914	missense	probably damaging	1.00
R0833:Grm8	UTSW	6	27363179	missense	probably damaging	1.00
R1301:Grm8	UTSW	6	27981201	missense	possibly damaging	0.94
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1471:Grm8	UTSW	6	27363309	missense	possibly damaging	0.79
R1554:Grm8	UTSW	6	28125853	missense	probably benign	0.01
R1638:Grm8	UTSW	6	28125883	nonsense	probably null
R1763:Grm8	UTSW	6	27285867	missense	possibly damaging	0.79
R1899:Grm8	UTSW	6	28125895	missense	probably damaging	1.00
R1902:Grm8	UTSW	6	27429482	missense	probably damaging	1.00
R1916:Grm8	UTSW	6	27363584	missense	probably benign	0.01
R2257:Grm8	UTSW	6	27760225	missense	probably damaging	0.98
R2351:Grm8	UTSW	6	28126119	missense	possibly damaging	0.66
R2396:Grm8	UTSW	6	27761242	missense	probably damaging	0.98
R3802:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3803:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3804:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3830:Grm8	UTSW	6	27761229	nonsense	probably null
R3844:Grm8	UTSW	6	27429508	missense	possibly damaging	0.69
R4006:Grm8	UTSW	6	27981230	missense	probably damaging	1.00
R4077:Grm8	UTSW	6	27760209	missense	probably benign	0.01
R4395:Grm8	UTSW	6	27429432	missense	probably damaging	0.98
R4436:Grm8	UTSW	6	27761238	missense	possibly damaging	0.48
R4810:Grm8	UTSW	6	27761296	missense	possibly damaging	0.87
R5357:Grm8	UTSW	6	27762419	missense	probably damaging	1.00
R5677:Grm8	UTSW	6	27761204	critical splice donor site	probably null
R5983:Grm8	UTSW	6	27760221	missense	probably benign	0.03
R5990:Grm8	UTSW	6	27363624	missense	probably damaging	1.00
R6365:Grm8	UTSW	6	27363227	missense	probably damaging	1.00
R6454:Grm8	UTSW	6	27363776	missense	possibly damaging	0.68
R6713:Grm8	UTSW	6	27363191	missense	probably damaging	1.00
R6960:Grm8	UTSW	6	27981282	missense	probably damaging	0.98
R7194:Grm8	UTSW	6	27618487	missense	probably benign	0.01
R7259:Grm8	UTSW	6	27760176	missense	probably null	0.99
R7305:Grm8	UTSW	6	27761355	missense	possibly damaging	0.51
R7421:Grm8	UTSW	6	27762477	missense	possibly damaging	0.66
R7561:Grm8	UTSW	6	27429525	missense	probably benign	0.44
R7605:Grm8	UTSW	6	27618679	missense	probably damaging	1.00
R7651:Grm8	UTSW	6	27760258	missense	possibly damaging	0.46
R7775:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7778:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7781:Grm8	UTSW	6	27285787	missense	probably benign
R7785:Grm8	UTSW	6	27618637	missense	probably damaging	0.99
R7898:Grm8	UTSW	6	27762423	missense	probably damaging	1.00
R8272:Grm8	UTSW	6	27363282	missense	probably damaging	1.00
R8274:Grm8	UTSW	6	27761336	missense	probably benign	0.31
R8501:Grm8	UTSW	6	27618541	missense	probably damaging	0.98
R8695:Grm8	UTSW	6	28126031	missense	probably benign	0.01
R8824:Grm8	UTSW	6	27761352	missense	probably damaging	1.00
R8869:Grm8	UTSW	6	27363753	missense	probably benign	0.26
R9322:Grm8	UTSW	6	27363729	missense	possibly damaging	0.88
R9337:Grm8	UTSW	6	27761215	missense	probably benign	0.01
R9518:Grm8	UTSW	6	27429470	missense	probably benign	0.01
RF013:Grm8	UTSW	6	27363780	missense	probably damaging	1.00
Z1176:Grm8	UTSW	6	28126027	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TCCTTGGTGGAAACGCAAGC -3'
(R):5'- TAATAAGGACCCCGATCTCCTCTC -3'

Sequencing Primer
(F):5'- CACAGAATGCCCCACTTGAGG -3'
(R):5'- TTGACACATGTTCCAGGGAC -3'

Posted On

2015-03-25