Incidental Mutation 'R3801:Grm8'
ID 272974
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Name glutamate receptor, metabotropic 8
Synonyms mGluR8, Gprc1h
MMRRC Submission 040760-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 27275120-28135094 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 28125635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 164 (N164H)
Ref Sequence ENSEMBL: ENSMUSP00000120394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897] [ENSMUST00000132755]
AlphaFold P47743
Predicted Effect possibly damaging
Transcript: ENSMUST00000090512
AA Change: N164H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: N164H

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115323
AA Change: N164H

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: N164H

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115324
AA Change: N164H

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: N164H

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131897
AA Change: N164H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211
AA Change: N164H

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 294 5.8e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146727
Meta Mutation Damage Score 0.2839 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,974,922 (GRCm39) E54K probably benign Het
Als2 A C 1: 59,206,358 (GRCm39) M1634R probably damaging Het
Ankfy1 T C 11: 72,640,246 (GRCm39) S531P probably benign Het
Atp6v1e1 A G 6: 120,778,020 (GRCm39) Y172H probably benign Het
Brd1 C T 15: 88,601,243 (GRCm39) V464M probably damaging Het
Btaf1 A T 19: 36,963,948 (GRCm39) T840S probably benign Het
Btaf1 A T 19: 36,966,373 (GRCm39) H1047L probably benign Het
Cacnb2 A G 2: 14,829,074 (GRCm39) D3G possibly damaging Het
Capn13 G A 17: 73,646,396 (GRCm39) P339L probably benign Het
Cgrrf1 G T 14: 47,069,820 (GRCm39) G30C probably damaging Het
Crnkl1 T C 2: 145,761,715 (GRCm39) D614G probably benign Het
Cyp2c23 C T 19: 43,995,478 (GRCm39) V430I probably benign Het
Dazl G A 17: 50,588,309 (GRCm39) R289W probably benign Het
Dsg1b C T 18: 20,523,260 (GRCm39) P96S probably damaging Het
Dusp14 A G 11: 83,939,535 (GRCm39) S169P possibly damaging Het
Egfem1 A G 3: 29,206,075 (GRCm39) D91G probably benign Het
Eif1 A G 11: 100,211,650 (GRCm39) K95E probably damaging Het
Fap C T 2: 62,376,994 (GRCm39) V191I probably benign Het
Flnc T C 6: 29,447,403 (GRCm39) Y1069H probably damaging Het
Fndc7 T C 3: 108,776,464 (GRCm39) T526A possibly damaging Het
Fras1 A T 5: 96,881,791 (GRCm39) T2508S probably benign Het
Gast T C 11: 100,227,636 (GRCm39) S73P probably damaging Het
Grap2 A G 15: 80,507,947 (GRCm39) T4A possibly damaging Het
Hyal5 A T 6: 24,876,523 (GRCm39) H132L probably benign Het
Iqcm C A 8: 76,396,021 (GRCm39) T188K possibly damaging Het
Kank4 A G 4: 98,668,370 (GRCm39) S26P probably damaging Het
Lipo3 C T 19: 33,762,257 (GRCm39) C80Y probably damaging Het
Lrrk2 A G 15: 91,621,314 (GRCm39) R963G probably benign Het
Lrtm2 G A 6: 119,294,444 (GRCm39) T229I probably damaging Het
Mb21d2 A T 16: 28,646,755 (GRCm39) D406E possibly damaging Het
Meikin T A 11: 54,290,697 (GRCm39) probably null Het
Mybl1 A T 1: 9,743,439 (GRCm39) F538I probably damaging Het
Nectin2 T C 7: 19,451,561 (GRCm39) D491G probably benign Het
Nf1 A G 11: 79,450,347 (GRCm39) D511G probably null Het
Nid2 T C 14: 19,860,065 (GRCm39) C1328R probably damaging Het
Nlrp1a T A 11: 71,013,529 (GRCm39) M574L probably benign Het
Nrap C T 19: 56,310,211 (GRCm39) D1595N probably damaging Het
Nrg3 G A 14: 38,098,391 (GRCm39) P496S probably damaging Het
Or4k41 A T 2: 111,279,910 (GRCm39) I142F probably benign Het
Pak3 G A X: 142,492,727 (GRCm39) V87I probably damaging Het
Phf8 T C X: 150,355,572 (GRCm39) S512P possibly damaging Het
Phkb G T 8: 86,648,858 (GRCm39) E225* probably null Het
Plaa T C 4: 94,458,125 (GRCm39) D615G probably damaging Het
Prdm12 A G 2: 31,541,959 (GRCm39) K223E probably damaging Het
Prkd1 C A 12: 50,430,205 (GRCm39) R634L possibly damaging Het
Rassf3 T A 10: 121,250,271 (GRCm39) I181F possibly damaging Het
Samd8 G A 14: 21,825,133 (GRCm39) V30M probably damaging Het
Sema4f A T 6: 82,895,608 (GRCm39) H308Q possibly damaging Het
Skint4 G T 4: 111,975,378 (GRCm39) V113L probably damaging Het
Slc16a10 G C 10: 39,932,620 (GRCm39) H314D possibly damaging Het
Slpi A G 2: 164,198,158 (GRCm39) L12P probably damaging Het
Smco1 A G 16: 32,092,716 (GRCm39) Y129C probably benign Het
Spag17 A G 3: 99,961,169 (GRCm39) K985R possibly damaging Het
Stc1 T C 14: 69,275,924 (GRCm39) I239T probably benign Het
Suclg2 A T 6: 95,474,649 (GRCm39) I372N probably damaging Het
Tmed4 C A 11: 6,224,233 (GRCm39) V80F probably damaging Het
Tnpo2 T A 8: 85,781,800 (GRCm39) probably null Het
Top1 A G 2: 160,544,688 (GRCm39) H268R probably damaging Het
Triobp A T 15: 78,857,900 (GRCm39) Q1167L probably benign Het
Txndc16 G A 14: 45,388,809 (GRCm39) P536L possibly damaging Het
Usp13 C T 3: 32,935,657 (GRCm39) A360V possibly damaging Het
Vhl G A 6: 113,606,423 (GRCm39) V147I probably benign Het
Vldlr A T 19: 27,195,021 (GRCm39) T3S probably damaging Het
Vps54 T A 11: 21,218,832 (GRCm39) D130E probably benign Het
Zfp808 T A 13: 62,319,897 (GRCm39) H375Q probably damaging Het
Zfp87 A T 13: 67,669,334 (GRCm39) N37K probably damaging Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27,363,800 (GRCm39) missense probably damaging 1.00
IGL01412:Grm8 APN 6 27,762,460 (GRCm39) missense probably damaging 1.00
IGL02329:Grm8 APN 6 27,363,115 (GRCm39) missense probably damaging 1.00
IGL02342:Grm8 APN 6 27,363,803 (GRCm39) missense probably benign 0.00
IGL02584:Grm8 APN 6 27,762,438 (GRCm39) missense probably benign 0.35
IGL03040:Grm8 APN 6 28,126,122 (GRCm39) start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27,363,262 (GRCm39) missense probably damaging 1.00
IGL03139:Grm8 APN 6 27,618,649 (GRCm39) missense probably damaging 1.00
IGL03287:Grm8 APN 6 27,760,254 (GRCm39) missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27,762,389 (GRCm39) missense probably damaging 0.99
R0266:Grm8 UTSW 6 27,285,895 (GRCm39) missense probably damaging 1.00
R0347:Grm8 UTSW 6 27,981,221 (GRCm39) missense probably benign 0.37
R0580:Grm8 UTSW 6 27,761,370 (GRCm39) splice site probably benign
R0698:Grm8 UTSW 6 27,363,913 (GRCm39) missense probably damaging 1.00
R0833:Grm8 UTSW 6 27,363,178 (GRCm39) missense probably damaging 1.00
R1301:Grm8 UTSW 6 27,981,200 (GRCm39) missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1471:Grm8 UTSW 6 27,363,308 (GRCm39) missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28,125,852 (GRCm39) missense probably benign 0.01
R1638:Grm8 UTSW 6 28,125,882 (GRCm39) nonsense probably null
R1763:Grm8 UTSW 6 27,285,866 (GRCm39) missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28,125,894 (GRCm39) missense probably damaging 1.00
R1902:Grm8 UTSW 6 27,429,481 (GRCm39) missense probably damaging 1.00
R1916:Grm8 UTSW 6 27,363,583 (GRCm39) missense probably benign 0.01
R2257:Grm8 UTSW 6 27,760,224 (GRCm39) missense probably damaging 0.98
R2351:Grm8 UTSW 6 28,126,118 (GRCm39) missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27,761,241 (GRCm39) missense probably damaging 0.98
R3802:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27,761,228 (GRCm39) nonsense probably null
R3844:Grm8 UTSW 6 27,429,507 (GRCm39) missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27,981,229 (GRCm39) missense probably damaging 1.00
R4077:Grm8 UTSW 6 27,760,208 (GRCm39) missense probably benign 0.01
R4395:Grm8 UTSW 6 27,429,431 (GRCm39) missense probably damaging 0.98
R4436:Grm8 UTSW 6 27,761,237 (GRCm39) missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27,761,295 (GRCm39) missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27,762,418 (GRCm39) missense probably damaging 1.00
R5677:Grm8 UTSW 6 27,761,203 (GRCm39) critical splice donor site probably null
R5983:Grm8 UTSW 6 27,760,220 (GRCm39) missense probably benign 0.03
R5990:Grm8 UTSW 6 27,363,623 (GRCm39) missense probably damaging 1.00
R6365:Grm8 UTSW 6 27,363,226 (GRCm39) missense probably damaging 1.00
R6454:Grm8 UTSW 6 27,363,775 (GRCm39) missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27,363,190 (GRCm39) missense probably damaging 1.00
R6960:Grm8 UTSW 6 27,981,281 (GRCm39) missense probably damaging 0.98
R7194:Grm8 UTSW 6 27,618,486 (GRCm39) missense probably benign 0.01
R7259:Grm8 UTSW 6 27,760,175 (GRCm39) missense probably null 0.99
R7305:Grm8 UTSW 6 27,761,354 (GRCm39) missense possibly damaging 0.51
R7421:Grm8 UTSW 6 27,762,476 (GRCm39) missense possibly damaging 0.66
R7561:Grm8 UTSW 6 27,429,524 (GRCm39) missense probably benign 0.44
R7605:Grm8 UTSW 6 27,618,678 (GRCm39) missense probably damaging 1.00
R7651:Grm8 UTSW 6 27,760,257 (GRCm39) missense possibly damaging 0.46
R7775:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7778:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7781:Grm8 UTSW 6 27,285,786 (GRCm39) missense probably benign
R7785:Grm8 UTSW 6 27,618,636 (GRCm39) missense probably damaging 0.99
R7898:Grm8 UTSW 6 27,762,422 (GRCm39) missense probably damaging 1.00
R8272:Grm8 UTSW 6 27,363,281 (GRCm39) missense probably damaging 1.00
R8274:Grm8 UTSW 6 27,761,335 (GRCm39) missense probably benign 0.31
R8501:Grm8 UTSW 6 27,618,540 (GRCm39) missense probably damaging 0.98
R8695:Grm8 UTSW 6 28,126,030 (GRCm39) missense probably benign 0.01
R8824:Grm8 UTSW 6 27,761,351 (GRCm39) missense probably damaging 1.00
R8869:Grm8 UTSW 6 27,363,752 (GRCm39) missense probably benign 0.26
R9322:Grm8 UTSW 6 27,363,728 (GRCm39) missense possibly damaging 0.88
R9337:Grm8 UTSW 6 27,761,214 (GRCm39) missense probably benign 0.01
R9518:Grm8 UTSW 6 27,429,469 (GRCm39) missense probably benign 0.01
RF013:Grm8 UTSW 6 27,363,779 (GRCm39) missense probably damaging 1.00
Z1176:Grm8 UTSW 6 28,126,026 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCCTTGGTGGAAACGCAAGC -3'
(R):5'- TAATAAGGACCCCGATCTCCTCTC -3'

Sequencing Primer
(F):5'- CACAGAATGCCCCACTTGAGG -3'
(R):5'- TTGACACATGTTCCAGGGAC -3'
Posted On 2015-03-25