Incidental Mutation 'R3801:Iqcm'
ID272983
Institutional Source Beutler Lab
Gene Symbol Iqcm
Ensembl Gene ENSMUSG00000031620
Gene NameIQ motif containing M
Synonyms1700007B14Rik
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3801 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location75448694-75984503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75669393 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 188 (T188K)
Ref Sequence ENSEMBL: ENSMUSP00000148495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034033] [ENSMUST00000121983] [ENSMUST00000212704]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034033
AA Change: T188K

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034033
Gene: ENSMUSG00000031620
AA Change: T188K

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121983
AA Change: T188K

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112901
Gene: ENSMUSG00000031620
AA Change: T188K

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212704
AA Change: T188K

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Iqcm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Iqcm APN 8 75888560 missense probably damaging 1.00
IGL02835:Iqcm APN 8 75554883 utr 5 prime probably benign
R0056:Iqcm UTSW 8 75753386 missense probably benign
R2146:Iqcm UTSW 8 75888613 missense probably damaging 1.00
R2910:Iqcm UTSW 8 75714776 missense probably benign
R3804:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3834:Iqcm UTSW 8 75577752 missense possibly damaging 0.93
R3897:Iqcm UTSW 8 75753400 missense probably damaging 1.00
R4447:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4448:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4450:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4687:Iqcm UTSW 8 75762989 missense probably damaging 1.00
R4810:Iqcm UTSW 8 75888653 missense probably damaging 1.00
R4845:Iqcm UTSW 8 75746352 missense probably damaging 0.99
R4856:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R4886:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R5063:Iqcm UTSW 8 75746286 missense probably damaging 1.00
R5460:Iqcm UTSW 8 75714789 missense probably benign
R6403:Iqcm UTSW 8 75577996 critical splice donor site probably null
R6667:Iqcm UTSW 8 75753352 missense probably damaging 1.00
R7187:Iqcm UTSW 8 75753416 missense probably benign 0.22
R7263:Iqcm UTSW 8 75763073 missense probably benign
R7701:Iqcm UTSW 8 75554911 missense probably benign 0.02
R7916:Iqcm UTSW 8 75577950 missense probably benign
R7938:Iqcm UTSW 8 75577968 missense probably benign
R7974:Iqcm UTSW 8 75554892 start codon destroyed probably null 0.66
R8039:Iqcm UTSW 8 75763105 missense probably damaging 1.00
RF002:Iqcm UTSW 8 75577899 missense probably benign 0.01
X0018:Iqcm UTSW 8 75984212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGGCTATCGCTTCTTC -3'
(R):5'- GCTGAAGAAATGGCCTTCAATGAAG -3'

Sequencing Primer
(F):5'- TCATCTCTCTCTGACGAGATGACAAG -3'
(R):5'- TTGAGCAGATCCATGAGG -3'
Posted On2015-03-25