Incidental Mutation 'R3801:Tnpo2'
ID 272985
Institutional Source Beutler Lab
Gene Symbol Tnpo2
Ensembl Gene ENSMUSG00000031691
Gene Name transportin 2 (importin 3, karyopherin beta 2b)
Synonyms Kpnb2b, TRN2, 1110034O24Rik
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 85036915-85057583 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 85055171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000095220] [ENSMUST00000166592] [ENSMUST00000166592] [ENSMUST00000211601] [ENSMUST00000211601]
AlphaFold Q99LG2
Predicted Effect probably null
Transcript: ENSMUST00000093360
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095220
SMART Domains Protein: ENSMUSP00000092845
Gene: ENSMUSG00000008167

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
FBOX 82 123 7.47e-4 SMART
WD40 161 201 2.98e-1 SMART
WD40 210 252 4.55e-3 SMART
WD40 256 292 7.8e-2 SMART
WD40 296 333 1.03e0 SMART
WD40 377 415 2.57e0 SMART
Blast:WD40 419 455 8e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156084
Predicted Effect probably null
Transcript: ENSMUST00000166592
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166592
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210576
Predicted Effect probably null
Transcript: ENSMUST00000211601
Predicted Effect probably null
Transcript: ENSMUST00000211601
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Tnpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tnpo2 APN 8 85040526 missense probably damaging 0.98
IGL01843:Tnpo2 APN 8 85050508 missense probably damaging 0.99
IGL02475:Tnpo2 APN 8 85050502 missense probably benign 0.33
IGL02536:Tnpo2 APN 8 85045067 missense probably benign
IGL02644:Tnpo2 APN 8 85044480 missense possibly damaging 0.62
IGL02721:Tnpo2 APN 8 85054690 critical splice acceptor site probably null
IGL03155:Tnpo2 APN 8 85045080 missense probably benign 0.03
IGL03198:Tnpo2 APN 8 85051718 missense possibly damaging 0.75
boisterous UTSW 8 85050157 missense probably damaging 1.00
Raucous UTSW 8 85040628 missense probably damaging 1.00
R0127:Tnpo2 UTSW 8 85040628 missense probably damaging 1.00
R0456:Tnpo2 UTSW 8 85054416 missense probably damaging 1.00
R0505:Tnpo2 UTSW 8 85047362 missense probably benign 0.01
R0513:Tnpo2 UTSW 8 85053529 missense probably benign 0.00
R0531:Tnpo2 UTSW 8 85050157 missense probably damaging 1.00
R0595:Tnpo2 UTSW 8 85052041 nonsense probably null
R1113:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1308:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1851:Tnpo2 UTSW 8 85051772 missense probably damaging 1.00
R1965:Tnpo2 UTSW 8 85045317 critical splice donor site probably null
R2057:Tnpo2 UTSW 8 85050113 missense probably damaging 1.00
R2184:Tnpo2 UTSW 8 85053846 missense probably benign 0.35
R3871:Tnpo2 UTSW 8 85054751 missense probably null 0.98
R4095:Tnpo2 UTSW 8 85038419 missense probably damaging 1.00
R4611:Tnpo2 UTSW 8 85053803 missense probably benign 0.38
R4925:Tnpo2 UTSW 8 85050025 missense probably damaging 1.00
R5744:Tnpo2 UTSW 8 85051894 nonsense probably null
R6107:Tnpo2 UTSW 8 85053475 missense probably damaging 1.00
R6581:Tnpo2 UTSW 8 85055404 missense probably damaging 1.00
R6586:Tnpo2 UTSW 8 85045202 missense possibly damaging 0.83
R7173:Tnpo2 UTSW 8 85055078 missense probably benign 0.05
R7196:Tnpo2 UTSW 8 85047137 missense possibly damaging 0.91
R7382:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7383:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7384:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7385:Tnpo2 UTSW 8 85050119 missense probably damaging 0.98
R7453:Tnpo2 UTSW 8 85055022 missense probably damaging 1.00
R7488:Tnpo2 UTSW 8 85055034 missense probably benign 0.03
R7638:Tnpo2 UTSW 8 85044415 missense probably benign 0.01
R8004:Tnpo2 UTSW 8 85044699 missense probably benign 0.26
R8021:Tnpo2 UTSW 8 85055206 missense probably damaging 1.00
R8042:Tnpo2 UTSW 8 85051559 missense probably damaging 1.00
R8403:Tnpo2 UTSW 8 85047297 missense probably benign 0.02
R8794:Tnpo2 UTSW 8 85038485 missense probably benign 0.14
R9031:Tnpo2 UTSW 8 85053534 missense probably benign 0.17
R9218:Tnpo2 UTSW 8 85049980 missense possibly damaging 0.75
X0027:Tnpo2 UTSW 8 85044895 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCACGTCCCTTAGGAACATC -3'
(R):5'- GGAACTGCTCTGAGAACTGTTGC -3'

Sequencing Primer
(F):5'- TCCCTTAGGAACATCCGGGAC -3'
(R):5'- CCAACTTGGTCTTTGAAGCCATGG -3'
Posted On 2015-03-25