Incidental Mutation 'R3801:Vps54'
ID 272992
Institutional Source Beutler Lab
Gene Symbol Vps54
Ensembl Gene ENSMUSG00000020128
Gene Name VPS54 GARP complex subunit
Synonyms 5330404P15Rik, wr, mSLP8, Vps54l
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock # R3801 (G1)
Quality Score 219
Status Not validated
Chromosome 11
Chromosomal Location 21239281-21321136 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21268832 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 130 (D130E)
Ref Sequence ENSEMBL: ENSMUSP00000105206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000109578] [ENSMUST00000132017]
AlphaFold Q5SPW0
Predicted Effect probably benign
Transcript: ENSMUST00000006221
AA Change: D142E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128
AA Change: D142E

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 198 364 2.1e-12 PFAM
Pfam:Vps54 736 868 3.3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109578
AA Change: D130E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128
AA Change: D130E

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 186 352 2.3e-12 PFAM
Pfam:Vps54 723 857 1.6e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132017
AA Change: D16E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128
AA Change: D16E

DomainStartEndE-ValueType
Pfam:DUF2450 72 238 1.4e-12 PFAM
Pfam:Vps54 573 707 7.8e-64 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show progressive ataxia, tremors, and limb paralysis with degeneration of motor nerve cells of brainstem and spinal cord and atrophy of skeletal muscle beginning about 3-weeks of age. Mutants are sterile and most die by 3-months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Vps54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Vps54 APN 11 21277909 missense possibly damaging 0.74
IGL01070:Vps54 APN 11 21312268 missense probably damaging 1.00
IGL01398:Vps54 APN 11 21295403 splice site probably benign
IGL01450:Vps54 APN 11 21291135 missense probably benign 0.00
IGL01611:Vps54 APN 11 21311082 missense probably damaging 1.00
IGL01801:Vps54 APN 11 21275131 critical splice donor site probably null
IGL01872:Vps54 APN 11 21306940 missense probably damaging 0.99
IGL02071:Vps54 APN 11 21275071 missense probably null 0.00
IGL02186:Vps54 APN 11 21306947 missense probably damaging 1.00
IGL03358:Vps54 APN 11 21268799 missense probably damaging 1.00
muddle UTSW 11 21277670 splice site probably null
R0031:Vps54 UTSW 11 21312899 missense probably damaging 1.00
R0147:Vps54 UTSW 11 21300259 missense probably benign 0.02
R0158:Vps54 UTSW 11 21306962 missense probably damaging 1.00
R0385:Vps54 UTSW 11 21306381 missense possibly damaging 0.94
R0420:Vps54 UTSW 11 21311071 splice site probably benign
R0582:Vps54 UTSW 11 21300137 missense probably damaging 1.00
R0602:Vps54 UTSW 11 21306434 missense possibly damaging 0.92
R1051:Vps54 UTSW 11 21278001 frame shift probably null
R1280:Vps54 UTSW 11 21277868 missense possibly damaging 0.88
R1720:Vps54 UTSW 11 21306519 missense probably damaging 1.00
R1875:Vps54 UTSW 11 21300251 missense probably benign 0.00
R1883:Vps54 UTSW 11 21312967 missense possibly damaging 0.91
R1971:Vps54 UTSW 11 21292051 missense probably damaging 1.00
R2063:Vps54 UTSW 11 21277955 missense probably damaging 1.00
R2171:Vps54 UTSW 11 21298810 missense probably benign 0.16
R2518:Vps54 UTSW 11 21306394 missense probably benign 0.01
R4049:Vps54 UTSW 11 21300183 missense probably benign 0.00
R4108:Vps54 UTSW 11 21312877 missense probably benign 0.02
R4560:Vps54 UTSW 11 21312260 missense possibly damaging 0.91
R4668:Vps54 UTSW 11 21299989 missense probably benign 0.04
R4772:Vps54 UTSW 11 21312952 missense probably damaging 1.00
R5061:Vps54 UTSW 11 21319881 utr 3 prime probably benign
R5611:Vps54 UTSW 11 21311130 missense possibly damaging 0.65
R5638:Vps54 UTSW 11 21308799 missense probably damaging 1.00
R5670:Vps54 UTSW 11 21264864 missense probably damaging 1.00
R7095:Vps54 UTSW 11 21271720 missense probably benign 0.12
R7175:Vps54 UTSW 11 21315028 critical splice donor site probably null
R7179:Vps54 UTSW 11 21298791 missense probably damaging 1.00
R7269:Vps54 UTSW 11 21277670 splice site probably null
R7286:Vps54 UTSW 11 21275005 missense probably benign 0.30
R7344:Vps54 UTSW 11 21274999 missense probably damaging 1.00
R7552:Vps54 UTSW 11 21298831 missense probably benign 0.08
R7897:Vps54 UTSW 11 21263307 missense probably benign 0.02
R8011:Vps54 UTSW 11 21275095 missense probably damaging 0.99
R8193:Vps54 UTSW 11 21292045 missense probably benign 0.00
R8282:Vps54 UTSW 11 21300464 intron probably benign
R8534:Vps54 UTSW 11 21277706 missense probably benign 0.05
R8559:Vps54 UTSW 11 21264815 missense probably damaging 1.00
R9034:Vps54 UTSW 11 21263273 missense probably benign 0.29
R9096:Vps54 UTSW 11 21277913 missense possibly damaging 0.90
R9253:Vps54 UTSW 11 21308771 missense probably benign
R9359:Vps54 UTSW 11 21292108 missense probably benign
R9367:Vps54 UTSW 11 21300234 missense probably benign 0.00
Z1177:Vps54 UTSW 11 21263206 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTCCATAATGGTATTTGGTTCTG -3'
(R):5'- CAGCCTAGCATACTAAGTTTCAATCC -3'

Sequencing Primer
(F):5'- GAACATTTTGATGCTTTGAGT -3'
(R):5'- GTTAAGCTATGCTTATTGTCTA -3'
Posted On 2015-03-25