Mutagenetix > Incidental Mutations

Incidental Mutation 'R3801:Vps54'

272992

Institutional Source

Beutler Lab

Gene Symbol

Vps54

Ensembl Gene

ENSMUSG00000020128

Gene Name

VPS54 GARP complex subunit

Synonyms

5330404P15Rik, wr, mSLP8, Vps54l

MMRRC Submission

040760-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.887) question?

Stock #

R3801 (G1)

Quality Score

219

Status

Not validated

Chromosome

Chromosomal Location

21239281-21321136 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21268832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 130 (D130E)

Ref Sequence

ENSEMBL: ENSMUSP00000105206 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000109578] [ENSMUST00000132017]

AlphaFold

Q5SPW0

Predicted Effect

probably benign
Transcript: ENSMUST00000006221
AA Change: D142E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128
AA Change: D142E

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:DUF2450	198	364	2.1e-12	PFAM
Pfam:Vps54	736	868	3.3e-56	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109578
AA Change: D130E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128
AA Change: D130E

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:DUF2450	186	352	2.3e-12	PFAM
Pfam:Vps54	723	857	1.6e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132017
AA Change: D16E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128
AA Change: D16E

Domain	Start	End	E-Value	Type
Pfam:DUF2450	72	238	1.4e-12	PFAM
Pfam:Vps54	573	707	7.8e-64	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show progressive ataxia, tremors, and limb paralysis with degeneration of motor nerve cells of brainstem and spinal cord and atrophy of skeletal muscle beginning about 3-weeks of age. Mutants are sterile and most die by 3-months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	C	T	8: 79,248,293	E54K	probably benign	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Ankfy1	T	C	11: 72,749,420	S531P	probably benign	Het
Atp6v1e1	A	G	6: 120,801,059	Y172H	probably benign	Het
Brd1	C	T	15: 88,717,040	V464M	probably damaging	Het
Btaf1	A	T	19: 36,986,548	T840S	probably benign	Het
Btaf1	A	T	19: 36,988,973	H1047L	probably benign	Het
Cacnb2	A	G	2: 14,824,263	D3G	possibly damaging	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Cgrrf1	G	T	14: 46,832,363	G30C	probably damaging	Het
Crnkl1	T	C	2: 145,919,795	D614G	probably benign	Het
Cyp2c23	C	T	19: 44,007,039	V430I	probably benign	Het
Dazl	G	A	17: 50,281,281	R289W	probably benign	Het
Dsg1b	C	T	18: 20,390,203	P96S	probably damaging	Het
Dusp14	A	G	11: 84,048,709	S169P	possibly damaging	Het
Egfem1	A	G	3: 29,151,926	D91G	probably benign	Het
Eif1	A	G	11: 100,320,824	K95E	probably damaging	Het
Fap	C	T	2: 62,546,650	V191I	probably benign	Het
Flnc	T	C	6: 29,447,404	Y1069H	probably damaging	Het
Fndc7	T	C	3: 108,869,148	T526A	possibly damaging	Het
Fras1	A	T	5: 96,733,932	T2508S	probably benign	Het
Gast	T	C	11: 100,336,810	S73P	probably damaging	Het
Grap2	A	G	15: 80,623,746	T4A	possibly damaging	Het
Grm8	T	G	6: 28,125,636	N164H	possibly damaging	Het
Hyal5	A	T	6: 24,876,524	H132L	probably benign	Het
Iqcm	C	A	8: 75,669,393	T188K	possibly damaging	Het
Kank4	A	G	4: 98,780,133	S26P	probably damaging	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Lrrk2	A	G	15: 91,737,111	R963G	probably benign	Het
Lrtm2	G	A	6: 119,317,483	T229I	probably damaging	Het
Mb21d2	A	T	16: 28,828,003	D406E	possibly damaging	Het
Meikin	T	A	11: 54,399,871		probably null	Het
Mybl1	A	T	1: 9,673,214	F538I	probably damaging	Het
Nectin2	T	C	7: 19,717,636	D491G	probably benign	Het
Nf1	A	G	11: 79,559,521	D511G	probably null	Het
Nid2	T	C	14: 19,809,997	C1328R	probably damaging	Het
Nlrp1a	T	A	11: 71,122,703	M574L	probably benign	Het
Nrap	C	T	19: 56,321,779	D1595N	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1287	A	T	2: 111,449,565	I142F	probably benign	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Phkb	G	T	8: 85,922,229	E225*	probably null	Het
Plaa	T	C	4: 94,569,888	D615G	probably damaging	Het
Prdm12	A	G	2: 31,651,947	K223E	probably damaging	Het
Prkd1	C	A	12: 50,383,422	R634L	possibly damaging	Het
Rassf3	T	A	10: 121,414,366	I181F	possibly damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Sema4f	A	T	6: 82,918,627	H308Q	possibly damaging	Het
Skint4	G	T	4: 112,118,181	V113L	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slpi	A	G	2: 164,356,238	L12P	probably damaging	Het
Smco1	A	G	16: 32,273,898	Y129C	probably benign	Het
Spag17	A	G	3: 100,053,853	K985R	possibly damaging	Het
Stc1	T	C	14: 69,038,475	I239T	probably benign	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Tmed4	C	A	11: 6,274,233	V80F	probably damaging	Het
Tnpo2	T	A	8: 85,055,171		probably null	Het
Top1	A	G	2: 160,702,768	H268R	probably damaging	Het
Triobp	A	T	15: 78,973,700	Q1167L	probably benign	Het
Txndc16	G	A	14: 45,151,352	P536L	possibly damaging	Het
Usp13	C	T	3: 32,881,508	A360V	possibly damaging	Het
Vhl	G	A	6: 113,629,462	V147I	probably benign	Het
Vldlr	A	T	19: 27,217,621	T3S	probably damaging	Het
Zfp808	T	A	13: 62,172,083	H375Q	probably damaging	Het
Zfp87	A	T	13: 67,521,215	N37K	probably damaging	Het

Other mutations in Vps54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Vps54	APN	11	21277909	missense	possibly damaging	0.74
IGL01070:Vps54	APN	11	21312268	missense	probably damaging	1.00
IGL01398:Vps54	APN	11	21295403	splice site	probably benign
IGL01450:Vps54	APN	11	21291135	missense	probably benign	0.00
IGL01611:Vps54	APN	11	21311082	missense	probably damaging	1.00
IGL01801:Vps54	APN	11	21275131	critical splice donor site	probably null
IGL01872:Vps54	APN	11	21306940	missense	probably damaging	0.99
IGL02071:Vps54	APN	11	21275071	missense	probably null	0.00
IGL02186:Vps54	APN	11	21306947	missense	probably damaging	1.00
IGL03358:Vps54	APN	11	21268799	missense	probably damaging	1.00
muddle	UTSW	11	21277670	splice site	probably null
R0031:Vps54	UTSW	11	21312899	missense	probably damaging	1.00
R0147:Vps54	UTSW	11	21300259	missense	probably benign	0.02
R0158:Vps54	UTSW	11	21306962	missense	probably damaging	1.00
R0385:Vps54	UTSW	11	21306381	missense	possibly damaging	0.94
R0420:Vps54	UTSW	11	21311071	splice site	probably benign
R0582:Vps54	UTSW	11	21300137	missense	probably damaging	1.00
R0602:Vps54	UTSW	11	21306434	missense	possibly damaging	0.92
R1051:Vps54	UTSW	11	21278001	frame shift	probably null
R1280:Vps54	UTSW	11	21277868	missense	possibly damaging	0.88
R1720:Vps54	UTSW	11	21306519	missense	probably damaging	1.00
R1875:Vps54	UTSW	11	21300251	missense	probably benign	0.00
R1883:Vps54	UTSW	11	21312967	missense	possibly damaging	0.91
R1971:Vps54	UTSW	11	21292051	missense	probably damaging	1.00
R2063:Vps54	UTSW	11	21277955	missense	probably damaging	1.00
R2171:Vps54	UTSW	11	21298810	missense	probably benign	0.16
R2518:Vps54	UTSW	11	21306394	missense	probably benign	0.01
R4049:Vps54	UTSW	11	21300183	missense	probably benign	0.00
R4108:Vps54	UTSW	11	21312877	missense	probably benign	0.02
R4560:Vps54	UTSW	11	21312260	missense	possibly damaging	0.91
R4668:Vps54	UTSW	11	21299989	missense	probably benign	0.04
R4772:Vps54	UTSW	11	21312952	missense	probably damaging	1.00
R5061:Vps54	UTSW	11	21319881	utr 3 prime	probably benign
R5611:Vps54	UTSW	11	21311130	missense	possibly damaging	0.65
R5638:Vps54	UTSW	11	21308799	missense	probably damaging	1.00
R5670:Vps54	UTSW	11	21264864	missense	probably damaging	1.00
R7095:Vps54	UTSW	11	21271720	missense	probably benign	0.12
R7175:Vps54	UTSW	11	21315028	critical splice donor site	probably null
R7179:Vps54	UTSW	11	21298791	missense	probably damaging	1.00
R7269:Vps54	UTSW	11	21277670	splice site	probably null
R7286:Vps54	UTSW	11	21275005	missense	probably benign	0.30
R7344:Vps54	UTSW	11	21274999	missense	probably damaging	1.00
R7552:Vps54	UTSW	11	21298831	missense	probably benign	0.08
R7897:Vps54	UTSW	11	21263307	missense	probably benign	0.02
R8011:Vps54	UTSW	11	21275095	missense	probably damaging	0.99
R8193:Vps54	UTSW	11	21292045	missense	probably benign	0.00
R8282:Vps54	UTSW	11	21300464	intron	probably benign
R8534:Vps54	UTSW	11	21277706	missense	probably benign	0.05
R8559:Vps54	UTSW	11	21264815	missense	probably damaging	1.00
R9034:Vps54	UTSW	11	21263273	missense	probably benign	0.29
R9096:Vps54	UTSW	11	21277913	missense	possibly damaging	0.90
R9253:Vps54	UTSW	11	21308771	missense	probably benign
R9359:Vps54	UTSW	11	21292108	missense	probably benign
R9367:Vps54	UTSW	11	21300234	missense	probably benign	0.00
Z1177:Vps54	UTSW	11	21263206	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTCCATAATGGTATTTGGTTCTG -3'
(R):5'- CAGCCTAGCATACTAAGTTTCAATCC -3'

Sequencing Primer
(F):5'- GAACATTTTGATGCTTTGAGT -3'
(R):5'- GTTAAGCTATGCTTATTGTCTA -3'

Posted On

2015-03-25