Incidental Mutation 'R3801:Meikin'
ID 272993
Institutional Source Beutler Lab
Gene Symbol Meikin
Ensembl Gene ENSMUSG00000020332
Gene Name meiotic kinetochore factor
Synonyms 4930404A10Rik
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 54370652-54426790 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 54399871 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094193]
AlphaFold Q5F2C3
Predicted Effect probably null
Transcript: ENSMUST00000094193
SMART Domains Protein: ENSMUSP00000091745
Gene: ENSMUSG00000020332

DomainStartEndE-ValueType
low complexity region 91 104 N/A INTRINSIC
low complexity region 361 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144172
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with defects in sister kinetochore pairing in meiosis I. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Meikin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Meikin APN 11 54398494 missense probably damaging 0.96
IGL02893:Meikin APN 11 54417758 missense possibly damaging 0.83
IGL03224:Meikin APN 11 54398460 missense probably benign 0.01
R0153:Meikin UTSW 11 54409642 splice site probably benign
R0634:Meikin UTSW 11 54390483 missense probably benign 0.22
R1374:Meikin UTSW 11 54398444 splice site probably benign
R1457:Meikin UTSW 11 54370941 nonsense probably null
R1659:Meikin UTSW 11 54390566 nonsense probably null
R1799:Meikin UTSW 11 54417787 missense probably benign 0.27
R2869:Meikin UTSW 11 54373507 missense possibly damaging 0.46
R2869:Meikin UTSW 11 54373507 missense possibly damaging 0.46
R4384:Meikin UTSW 11 54417787 nonsense probably null
R6343:Meikin UTSW 11 54370766 missense probably damaging 0.97
R6523:Meikin UTSW 11 54398501 nonsense probably null
R6878:Meikin UTSW 11 54411886 missense possibly damaging 0.83
R7214:Meikin UTSW 11 54411912 missense probably benign 0.40
R7969:Meikin UTSW 11 54409710 missense possibly damaging 0.83
R8462:Meikin UTSW 11 54399840 missense probably benign 0.01
R8680:Meikin UTSW 11 54426651 missense possibly damaging 0.46
R9136:Meikin UTSW 11 54394638 missense possibly damaging 0.82
R9169:Meikin UTSW 11 54394691 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGTAAAGTCATTAAAACCAGGGCC -3'
(R):5'- ACTCTGGTCACACATAACTCTG -3'

Sequencing Primer
(F):5'- CATTAAAACCAGGGCCTTGGTTTG -3'
(R):5'- AAATTCATGTATGGTCTGCATAGG -3'
Posted On 2015-03-25