Incidental Mutation 'R3801:Nlrp1a'
ID 272994
Institutional Source Beutler Lab
Gene Symbol Nlrp1a
Ensembl Gene ENSMUSG00000069830
Gene Name NLR family, pyrin domain containing 1A
Synonyms Nalp1
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 71092236-71144704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71122703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 574 (M574L)
Ref Sequence ENSEMBL: ENSMUSP00000104158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048514] [ENSMUST00000108518]
AlphaFold Q2LKU9
Predicted Effect probably benign
Transcript: ENSMUST00000048514
AA Change: M574L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038186
Gene: ENSMUSG00000069830
AA Change: M574L

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 4.6e-41 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 742 769 3.04e-5 SMART
low complexity region 856 870 N/A INTRINSIC
Pfam:FIIND 921 1173 1.6e-102 PFAM
Pfam:CARD 1209 1292 2.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108518
AA Change: M574L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104158
Gene: ENSMUSG00000069830
AA Change: M574L

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 1.1e-40 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 661 688 2.85e1 SMART
LRR 689 716 3.04e-5 SMART
Pfam:FIIND 819 1073 3e-136 PFAM
Pfam:CARD 1091 1174 8.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for an ENU-induced allele develop a multi-organ neutrophilic inflammatory disease. Homozygotes for the same ENU-induced allele develop a similar but lethal condition and exhibit neutrophilia, lymphopenia, splenomegaly, loss of peritoneal macrophages, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Nlrp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Nlrp1a APN 11 71092957 missense probably benign 0.00
IGL00771:Nlrp1a APN 11 71122741 nonsense probably null
IGL01408:Nlrp1a APN 11 71122916 missense probably benign 0.04
IGL01886:Nlrp1a APN 11 71123501 missense probably benign
IGL02221:Nlrp1a APN 11 71123118 missense possibly damaging 0.88
IGL02291:Nlrp1a APN 11 71122589 critical splice donor site probably null
IGL02375:Nlrp1a APN 11 71113513 nonsense probably null
IGL02408:Nlrp1a APN 11 71122630 missense probably benign 0.00
IGL02516:Nlrp1a APN 11 71114460 missense probably damaging 1.00
IGL02583:Nlrp1a APN 11 71123401 missense probably benign 0.03
IGL02622:Nlrp1a APN 11 71123000 missense possibly damaging 0.88
IGL02642:Nlrp1a APN 11 71123532 missense probably benign 0.12
IGL02823:Nlrp1a APN 11 71092423 missense probably damaging 0.96
IGL02859:Nlrp1a APN 11 71106086 missense possibly damaging 0.57
IGL02997:Nlrp1a APN 11 71123665 missense probably damaging 1.00
IGL03342:Nlrp1a APN 11 71122791 missense probably benign 0.19
Ants UTSW 11 71142338 missense probably benign 0.01
dreary UTSW 11 71113640 critical splice acceptor site probably null
picnic UTSW 11 71122747 missense possibly damaging 0.87
seedless UTSW 11 71123552 missense probably benign 0.44
watermelon UTSW 11 71122705 missense probably benign 0.08
R0022:Nlrp1a UTSW 11 71123381 missense probably damaging 0.99
R0345:Nlrp1a UTSW 11 71123675 missense probably damaging 1.00
R0360:Nlrp1a UTSW 11 71114004 intron probably benign
R0364:Nlrp1a UTSW 11 71114004 intron probably benign
R0566:Nlrp1a UTSW 11 71122942 missense probably benign 0.00
R1177:Nlrp1a UTSW 11 71107721 missense probably damaging 1.00
R1240:Nlrp1a UTSW 11 71113466 critical splice donor site probably null
R1263:Nlrp1a UTSW 11 71097122 missense probably benign 0.01
R1681:Nlrp1a UTSW 11 71142358 missense unknown
R1743:Nlrp1a UTSW 11 71124206 missense probably benign 0.04
R1826:Nlrp1a UTSW 11 71107980 intron probably benign
R1826:Nlrp1a UTSW 11 71122747 missense possibly damaging 0.87
R1981:Nlrp1a UTSW 11 71098938 missense probably damaging 1.00
R2083:Nlrp1a UTSW 11 71124220 missense possibly damaging 0.59
R2116:Nlrp1a UTSW 11 71114500 nonsense probably null
R2134:Nlrp1a UTSW 11 71124188 missense probably benign 0.00
R2148:Nlrp1a UTSW 11 71122907 nonsense probably null
R2301:Nlrp1a UTSW 11 71106101 missense possibly damaging 0.94
R3029:Nlrp1a UTSW 11 71123630 missense probably damaging 1.00
R3113:Nlrp1a UTSW 11 71123665 missense probably damaging 1.00
R3898:Nlrp1a UTSW 11 71122874 missense probably benign 0.00
R4254:Nlrp1a UTSW 11 71123028 nonsense probably null
R4397:Nlrp1a UTSW 11 71097204 missense probably benign 0.00
R4647:Nlrp1a UTSW 11 71097126 splice site probably null
R4740:Nlrp1a UTSW 11 71113640 critical splice acceptor site probably null
R4965:Nlrp1a UTSW 11 71092315 missense possibly damaging 0.94
R5009:Nlrp1a UTSW 11 71122705 missense probably benign 0.08
R5103:Nlrp1a UTSW 11 71099526 missense probably damaging 0.99
R5355:Nlrp1a UTSW 11 71124251 missense probably benign 0.00
R5577:Nlrp1a UTSW 11 71099574 missense probably damaging 1.00
R5892:Nlrp1a UTSW 11 71099645 missense probably damaging 1.00
R5949:Nlrp1a UTSW 11 71098989 missense probably damaging 1.00
R5964:Nlrp1a UTSW 11 71123020 missense probably benign 0.00
R6220:Nlrp1a UTSW 11 71142338 missense probably benign 0.01
R6564:Nlrp1a UTSW 11 71123572 missense probably damaging 1.00
R6586:Nlrp1a UTSW 11 71106073 missense probably benign 0.00
R6925:Nlrp1a UTSW 11 71092513 missense probably null 0.99
R7013:Nlrp1a UTSW 11 71123552 missense probably benign 0.44
R7155:Nlrp1a UTSW 11 71124079 missense possibly damaging 0.93
R7214:Nlrp1a UTSW 11 71123293 missense probably damaging 1.00
R7268:Nlrp1a UTSW 11 71124242 missense probably benign 0.00
R7388:Nlrp1a UTSW 11 71123197 missense probably damaging 1.00
R7404:Nlrp1a UTSW 11 71097093 nonsense probably null
R7409:Nlrp1a UTSW 11 71122808 missense probably benign 0.03
R7410:Nlrp1a UTSW 11 71123857 missense probably damaging 0.99
R7440:Nlrp1a UTSW 11 71092324 missense probably damaging 0.99
R7447:Nlrp1a UTSW 11 71092411 missense probably damaging 1.00
R7450:Nlrp1a UTSW 11 71107658 missense probably damaging 1.00
R7569:Nlrp1a UTSW 11 71109043 missense probably benign 0.00
R7600:Nlrp1a UTSW 11 71098914 missense probably damaging 0.96
R7634:Nlrp1a UTSW 11 71099528 missense probably benign 0.19
R7734:Nlrp1a UTSW 11 71108000 missense unknown
R7747:Nlrp1a UTSW 11 71123408 missense possibly damaging 0.85
R8471:Nlrp1a UTSW 11 71123059 missense possibly damaging 0.68
R8482:Nlrp1a UTSW 11 71109075 splice site probably null
R9008:Nlrp1a UTSW 11 71123909 missense possibly damaging 0.89
R9028:Nlrp1a UTSW 11 71122993 missense probably benign 0.27
X0026:Nlrp1a UTSW 11 71142316 missense probably benign 0.18
Z1177:Nlrp1a UTSW 11 71123169 missense probably benign 0.27
Z1186:Nlrp1a UTSW 11 71092243 missense probably benign
Z1186:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1186:Nlrp1a UTSW 11 71099616 missense probably benign
Z1186:Nlrp1a UTSW 11 71124088 missense probably benign
Z1186:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1187:Nlrp1a UTSW 11 71092243 missense probably benign
Z1187:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1187:Nlrp1a UTSW 11 71099616 missense probably benign
Z1187:Nlrp1a UTSW 11 71124088 missense probably benign
Z1187:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1188:Nlrp1a UTSW 11 71092243 missense probably benign
Z1188:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1188:Nlrp1a UTSW 11 71099616 missense probably benign
Z1188:Nlrp1a UTSW 11 71124088 missense probably benign
Z1188:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1189:Nlrp1a UTSW 11 71092243 missense probably benign
Z1189:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1189:Nlrp1a UTSW 11 71099616 missense probably benign
Z1189:Nlrp1a UTSW 11 71124088 missense probably benign
Z1189:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1190:Nlrp1a UTSW 11 71092243 missense probably benign
Z1190:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1190:Nlrp1a UTSW 11 71099616 missense probably benign
Z1190:Nlrp1a UTSW 11 71124088 missense probably benign
Z1190:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1191:Nlrp1a UTSW 11 71092243 missense probably benign
Z1191:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1191:Nlrp1a UTSW 11 71099616 missense probably benign
Z1191:Nlrp1a UTSW 11 71124088 missense probably benign
Z1191:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1192:Nlrp1a UTSW 11 71092243 missense probably benign
Z1192:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1192:Nlrp1a UTSW 11 71099616 missense probably benign
Z1192:Nlrp1a UTSW 11 71124088 missense probably benign
Z1192:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGGGATCATGGGATTCACAG -3'
(R):5'- GCCTTCATGGAAAGACAAAGTTG -3'

Sequencing Primer
(F):5'- TGGGATCATGGGATTCACAGATAATC -3'
(R):5'- TGGCACATCCTAGGGAAATCC -3'
Posted On 2015-03-25