Incidental Mutation 'R3801:Triobp'
ID 273009
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 040760-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3801 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78857900 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1167 (Q1167L)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228] [ENSMUST00000229270]
AlphaFold Q99KW3
Predicted Effect probably benign
Transcript: ENSMUST00000109689
AA Change: Q1167L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: Q1167L

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
AA Change: Q1167L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: Q1167L

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,974,922 (GRCm39) E54K probably benign Het
Als2 A C 1: 59,206,358 (GRCm39) M1634R probably damaging Het
Ankfy1 T C 11: 72,640,246 (GRCm39) S531P probably benign Het
Atp6v1e1 A G 6: 120,778,020 (GRCm39) Y172H probably benign Het
Brd1 C T 15: 88,601,243 (GRCm39) V464M probably damaging Het
Btaf1 A T 19: 36,963,948 (GRCm39) T840S probably benign Het
Btaf1 A T 19: 36,966,373 (GRCm39) H1047L probably benign Het
Cacnb2 A G 2: 14,829,074 (GRCm39) D3G possibly damaging Het
Capn13 G A 17: 73,646,396 (GRCm39) P339L probably benign Het
Cgrrf1 G T 14: 47,069,820 (GRCm39) G30C probably damaging Het
Crnkl1 T C 2: 145,761,715 (GRCm39) D614G probably benign Het
Cyp2c23 C T 19: 43,995,478 (GRCm39) V430I probably benign Het
Dazl G A 17: 50,588,309 (GRCm39) R289W probably benign Het
Dsg1b C T 18: 20,523,260 (GRCm39) P96S probably damaging Het
Dusp14 A G 11: 83,939,535 (GRCm39) S169P possibly damaging Het
Egfem1 A G 3: 29,206,075 (GRCm39) D91G probably benign Het
Eif1 A G 11: 100,211,650 (GRCm39) K95E probably damaging Het
Fap C T 2: 62,376,994 (GRCm39) V191I probably benign Het
Flnc T C 6: 29,447,403 (GRCm39) Y1069H probably damaging Het
Fndc7 T C 3: 108,776,464 (GRCm39) T526A possibly damaging Het
Fras1 A T 5: 96,881,791 (GRCm39) T2508S probably benign Het
Gast T C 11: 100,227,636 (GRCm39) S73P probably damaging Het
Grap2 A G 15: 80,507,947 (GRCm39) T4A possibly damaging Het
Grm8 T G 6: 28,125,635 (GRCm39) N164H possibly damaging Het
Hyal5 A T 6: 24,876,523 (GRCm39) H132L probably benign Het
Iqcm C A 8: 76,396,021 (GRCm39) T188K possibly damaging Het
Kank4 A G 4: 98,668,370 (GRCm39) S26P probably damaging Het
Lipo3 C T 19: 33,762,257 (GRCm39) C80Y probably damaging Het
Lrrk2 A G 15: 91,621,314 (GRCm39) R963G probably benign Het
Lrtm2 G A 6: 119,294,444 (GRCm39) T229I probably damaging Het
Mb21d2 A T 16: 28,646,755 (GRCm39) D406E possibly damaging Het
Meikin T A 11: 54,290,697 (GRCm39) probably null Het
Mybl1 A T 1: 9,743,439 (GRCm39) F538I probably damaging Het
Nectin2 T C 7: 19,451,561 (GRCm39) D491G probably benign Het
Nf1 A G 11: 79,450,347 (GRCm39) D511G probably null Het
Nid2 T C 14: 19,860,065 (GRCm39) C1328R probably damaging Het
Nlrp1a T A 11: 71,013,529 (GRCm39) M574L probably benign Het
Nrap C T 19: 56,310,211 (GRCm39) D1595N probably damaging Het
Nrg3 G A 14: 38,098,391 (GRCm39) P496S probably damaging Het
Or4k41 A T 2: 111,279,910 (GRCm39) I142F probably benign Het
Pak3 G A X: 142,492,727 (GRCm39) V87I probably damaging Het
Phf8 T C X: 150,355,572 (GRCm39) S512P possibly damaging Het
Phkb G T 8: 86,648,858 (GRCm39) E225* probably null Het
Plaa T C 4: 94,458,125 (GRCm39) D615G probably damaging Het
Prdm12 A G 2: 31,541,959 (GRCm39) K223E probably damaging Het
Prkd1 C A 12: 50,430,205 (GRCm39) R634L possibly damaging Het
Rassf3 T A 10: 121,250,271 (GRCm39) I181F possibly damaging Het
Samd8 G A 14: 21,825,133 (GRCm39) V30M probably damaging Het
Sema4f A T 6: 82,895,608 (GRCm39) H308Q possibly damaging Het
Skint4 G T 4: 111,975,378 (GRCm39) V113L probably damaging Het
Slc16a10 G C 10: 39,932,620 (GRCm39) H314D possibly damaging Het
Slpi A G 2: 164,198,158 (GRCm39) L12P probably damaging Het
Smco1 A G 16: 32,092,716 (GRCm39) Y129C probably benign Het
Spag17 A G 3: 99,961,169 (GRCm39) K985R possibly damaging Het
Stc1 T C 14: 69,275,924 (GRCm39) I239T probably benign Het
Suclg2 A T 6: 95,474,649 (GRCm39) I372N probably damaging Het
Tmed4 C A 11: 6,224,233 (GRCm39) V80F probably damaging Het
Tnpo2 T A 8: 85,781,800 (GRCm39) probably null Het
Top1 A G 2: 160,544,688 (GRCm39) H268R probably damaging Het
Txndc16 G A 14: 45,388,809 (GRCm39) P536L possibly damaging Het
Usp13 C T 3: 32,935,657 (GRCm39) A360V possibly damaging Het
Vhl G A 6: 113,606,423 (GRCm39) V147I probably benign Het
Vldlr A T 19: 27,195,021 (GRCm39) T3S probably damaging Het
Vps54 T A 11: 21,218,832 (GRCm39) D130E probably benign Het
Zfp808 T A 13: 62,319,897 (GRCm39) H375Q probably damaging Het
Zfp87 A T 13: 67,669,334 (GRCm39) N37K probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCAGGACCTCAAAGTC -3'
(R):5'- TAGCAGGTCCCTCCAATCTAGG -3'

Sequencing Primer
(F):5'- CAGACACCCAGAGAAGAGCTG -3'
(R):5'- TCCCTCCAATCTAGGTCGGGTG -3'
Posted On 2015-03-25