Mutagenetix > Incidental Mutations

Incidental Mutation 'R3801:Brd1'

273012

Institutional Source

Beutler Lab

Gene Symbol

Brd1

Ensembl Gene

ENSMUSG00000022387

Gene Name

bromodomain containing 1

Synonyms

1110059H06Rik

MMRRC Submission

040760-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3801 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88687034-88734233 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 88717040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 464 (V464M)

Ref Sequence

ENSEMBL: ENSMUSP00000105007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088911] [ENSMUST00000109380] [ENSMUST00000109381]

AlphaFold

G5E8P1

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000088911

SMART Domains

Protein: ENSMUSP00000086300
Gene: ENSMUSG00000022387

Domain	Start	End	E-Value	Type
Pfam:EPL1	46	196	1.3e-38	PFAM
PHD	216	262	3.17e-7	SMART
PHD	326	389	5.16e-7	SMART
low complexity region	415	436	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	532	551	N/A	INTRINSIC
BROMO	560	668	8.59e-39	SMART
coiled coil region	704	726	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109380
AA Change: V464M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105006
Gene: ENSMUSG00000022387
AA Change: V464M

Domain	Start	End	E-Value	Type
Pfam:EPL1	46	196	3.3e-38	PFAM
PHD	216	262	3.17e-7	SMART
PHD	326	389	5.16e-7	SMART
low complexity region	415	436	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	532	551	N/A	INTRINSIC
BROMO	560	668	8.59e-39	SMART
coiled coil region	704	726	N/A	INTRINSIC
low complexity region	836	869	N/A	INTRINSIC
PWWP	927	1010	2.25e-39	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109381
AA Change: V464M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105007
Gene: ENSMUSG00000022387
AA Change: V464M

Domain	Start	End	E-Value	Type
Pfam:EPL1	47	196	3.9e-37	PFAM
PHD	216	262	3.17e-7	SMART
PHD	326	389	5.16e-7	SMART
low complexity region	415	436	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	532	551	N/A	INTRINSIC
BROMO	560	668	8.59e-39	SMART
coiled coil region	704	726	N/A	INTRINSIC
low complexity region	857	876	N/A	INTRINSIC
low complexity region	887	898	N/A	INTRINSIC
low complexity region	967	1000	N/A	INTRINSIC
PWWP	1058	1141	2.25e-39	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139515

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156155

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that localizes to the nucleus and can interact with DNA and histone tails. The encoded protein is a component of the MOZ/MORF acetyltransferase complex and can stimulate acetylation of histones H3 and H4, thereby potentially playing a role in gene activation. Variation in this gene is associated with schozophrenia and bipolar disorder in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal letahlity associated with severe growth retardation, abnormal lens, anemia, and impaired fetal hematopoiesis and erythropoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	C	T	8: 79,248,293	E54K	probably benign	Het
Als2	A	C	1: 59,167,199	M1634R	probably damaging	Het
Ankfy1	T	C	11: 72,749,420	S531P	probably benign	Het
Atp6v1e1	A	G	6: 120,801,059	Y172H	probably benign	Het
Btaf1	A	T	19: 36,986,548	T840S	probably benign	Het
Btaf1	A	T	19: 36,988,973	H1047L	probably benign	Het
Cacnb2	A	G	2: 14,824,263	D3G	possibly damaging	Het
Capn13	G	A	17: 73,339,401	P339L	probably benign	Het
Cgrrf1	G	T	14: 46,832,363	G30C	probably damaging	Het
Crnkl1	T	C	2: 145,919,795	D614G	probably benign	Het
Cyp2c23	C	T	19: 44,007,039	V430I	probably benign	Het
Dazl	G	A	17: 50,281,281	R289W	probably benign	Het
Dsg1b	C	T	18: 20,390,203	P96S	probably damaging	Het
Dusp14	A	G	11: 84,048,709	S169P	possibly damaging	Het
Egfem1	A	G	3: 29,151,926	D91G	probably benign	Het
Eif1	A	G	11: 100,320,824	K95E	probably damaging	Het
Fap	C	T	2: 62,546,650	V191I	probably benign	Het
Flnc	T	C	6: 29,447,404	Y1069H	probably damaging	Het
Fndc7	T	C	3: 108,869,148	T526A	possibly damaging	Het
Fras1	A	T	5: 96,733,932	T2508S	probably benign	Het
Gast	T	C	11: 100,336,810	S73P	probably damaging	Het
Grap2	A	G	15: 80,623,746	T4A	possibly damaging	Het
Grm8	T	G	6: 28,125,636	N164H	possibly damaging	Het
Hyal5	A	T	6: 24,876,524	H132L	probably benign	Het
Iqcm	C	A	8: 75,669,393	T188K	possibly damaging	Het
Kank4	A	G	4: 98,780,133	S26P	probably damaging	Het
Lipo1	C	T	19: 33,784,857	C80Y	probably damaging	Het
Lrrk2	A	G	15: 91,737,111	R963G	probably benign	Het
Lrtm2	G	A	6: 119,317,483	T229I	probably damaging	Het
Mb21d2	A	T	16: 28,828,003	D406E	possibly damaging	Het
Meikin	T	A	11: 54,399,871		probably null	Het
Mybl1	A	T	1: 9,673,214	F538I	probably damaging	Het
Nectin2	T	C	7: 19,717,636	D491G	probably benign	Het
Nf1	A	G	11: 79,559,521	D511G	probably null	Het
Nid2	T	C	14: 19,809,997	C1328R	probably damaging	Het
Nlrp1a	T	A	11: 71,122,703	M574L	probably benign	Het
Nrap	C	T	19: 56,321,779	D1595N	probably damaging	Het
Nrg3	G	A	14: 38,376,434	P496S	probably damaging	Het
Olfr1287	A	T	2: 111,449,565	I142F	probably benign	Het
Pak3	G	A	X: 143,709,731	V87I	probably damaging	Het
Phf8	T	C	X: 151,572,576	S512P	possibly damaging	Het
Phkb	G	T	8: 85,922,229	E225*	probably null	Het
Plaa	T	C	4: 94,569,888	D615G	probably damaging	Het
Prdm12	A	G	2: 31,651,947	K223E	probably damaging	Het
Prkd1	C	A	12: 50,383,422	R634L	possibly damaging	Het
Rassf3	T	A	10: 121,414,366	I181F	possibly damaging	Het
Samd8	G	A	14: 21,775,065	V30M	probably damaging	Het
Sema4f	A	T	6: 82,918,627	H308Q	possibly damaging	Het
Skint4	G	T	4: 112,118,181	V113L	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slpi	A	G	2: 164,356,238	L12P	probably damaging	Het
Smco1	A	G	16: 32,273,898	Y129C	probably benign	Het
Spag17	A	G	3: 100,053,853	K985R	possibly damaging	Het
Stc1	T	C	14: 69,038,475	I239T	probably benign	Het
Suclg2	A	T	6: 95,497,668	I372N	probably damaging	Het
Tmed4	C	A	11: 6,274,233	V80F	probably damaging	Het
Tnpo2	T	A	8: 85,055,171		probably null	Het
Top1	A	G	2: 160,702,768	H268R	probably damaging	Het
Triobp	A	T	15: 78,973,700	Q1167L	probably benign	Het
Txndc16	G	A	14: 45,151,352	P536L	possibly damaging	Het
Usp13	C	T	3: 32,881,508	A360V	possibly damaging	Het
Vhl	G	A	6: 113,629,462	V147I	probably benign	Het
Vldlr	A	T	19: 27,217,621	T3S	probably damaging	Het
Vps54	T	A	11: 21,268,832	D130E	probably benign	Het
Zfp808	T	A	13: 62,172,083	H375Q	probably damaging	Het
Zfp87	A	T	13: 67,521,215	N37K	probably damaging	Het

Other mutations in Brd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Brd1	APN	15	88730158	missense	probably benign	0.38
IGL00924:Brd1	APN	15	88729409	missense	possibly damaging	0.80
IGL01626:Brd1	APN	15	88700887	missense	probably damaging	1.00
IGL02569:Brd1	APN	15	88713929	missense	probably damaging	1.00
IGL02646:Brd1	APN	15	88700877	missense	probably damaging	1.00
IGL03130:Brd1	APN	15	88688374	missense	probably benign
IGL03343:Brd1	APN	15	88707251	missense	possibly damaging	0.89
spry	UTSW	15	88688355	missense	possibly damaging	0.47
R0089:Brd1	UTSW	15	88701198	missense	probably benign	0.06
R0112:Brd1	UTSW	15	88730383	missense	probably benign
R0165:Brd1	UTSW	15	88729777	missense	probably damaging	0.99
R0965:Brd1	UTSW	15	88717028	missense	probably damaging	1.00
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1534:Brd1	UTSW	15	88689663	missense	possibly damaging	0.68
R2245:Brd1	UTSW	15	88689860	critical splice donor site	probably null
R3611:Brd1	UTSW	15	88700944	missense	probably benign
R3751:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R3752:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R3753:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R4956:Brd1	UTSW	15	88730113	missense	probably damaging	1.00
R5382:Brd1	UTSW	15	88729564	missense	probably damaging	1.00
R5546:Brd1	UTSW	15	88701122	missense	probably benign	0.00
R5659:Brd1	UTSW	15	88713381	missense	probably benign	0.14
R5730:Brd1	UTSW	15	88717045	missense	probably benign	0.05
R5773:Brd1	UTSW	15	88689549	missense	probably benign	0.14
R6224:Brd1	UTSW	15	88688355	missense	possibly damaging	0.47
R6371:Brd1	UTSW	15	88713998	missense	probably benign
R7096:Brd1	UTSW	15	88713935	missense	probably damaging	1.00
R7722:Brd1	UTSW	15	88729559	missense	probably damaging	1.00
R8782:Brd1	UTSW	15	88730631	nonsense	probably null
R8869:Brd1	UTSW	15	88730526	missense	probably benign	0.09
R9079:Brd1	UTSW	15	88713950	missense	probably damaging	1.00
R9116:Brd1	UTSW	15	88701171	missense	possibly damaging	0.96
R9351:Brd1	UTSW	15	88730104	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTAGGGTCAGCAGCACATC -3'
(R):5'- GAACCTGGTGACTCTTGTGGAG -3'

Sequencing Primer
(F):5'- AGCAGCACATCCAGCCTGG -3'
(R):5'- TGACTCTTGTGGAGGATGAAATC -3'

Posted On

2015-03-25