Incidental Mutation 'R3801:Dazl'
ID273017
Institutional Source Beutler Lab
Gene Symbol Dazl
Ensembl Gene ENSMUSG00000010592
Gene Namedeleted in azoospermia-like
SynonymsDaz-like, Tpx2, Dazla, Tpx-2
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3801 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location50279394-50293599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50281281 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 289 (R289W)
Ref Sequence ENSEMBL: ENSMUSP00000010736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010736]
PDB Structure
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH RNA, UUGUUCUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH MVH RNA, UGUUC [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH SYCP3 RNA, UUGUUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000010736
AA Change: R289W

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010736
Gene: ENSMUSG00000010592
AA Change: R289W

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
RRM 41 111 2.16e-19 SMART
low complexity region 125 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit sterility with a complete absence of mature germ cells. In mutants, few spermatogonia enter meiosis, and those that do fail to proceed beyond pachytene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Dazl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Dazl APN 17 50293398 splice site probably benign
R0063:Dazl UTSW 17 152705859 missense probably damaging 1.00
R3961:Dazl UTSW 17 50288133 missense probably damaging 0.99
R4646:Dazl UTSW 17 50288155 missense probably damaging 1.00
R5310:Dazl UTSW 17 50281283 missense probably damaging 1.00
R5389:Dazl UTSW 17 50288690 missense probably benign 0.25
R5933:Dazl UTSW 17 50287753 critical splice donor site probably null
R6173:Dazl UTSW 17 50287571 missense probably benign 0.05
R7057:Dazl UTSW 17 50293406 start codon destroyed probably null
R7523:Dazl UTSW 17 50287541 missense probably damaging 0.97
R8393:Dazl UTSW 17 50281266 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCAATTTCAACTAAAAGTCCTTACGG -3'
(R):5'- TGCAGAGTTCTACAAGATTATCTCC -3'

Sequencing Primer
(F):5'- TCAACTAAAAGTCCTTACGGTAAATC -3'
(R):5'- AGTTCTACAAGATTATCTCCTCTTCC -3'
Posted On2015-03-25