Incidental Mutation 'R3801:Pak3'
ID 273027
Institutional Source Beutler Lab
Gene Symbol Pak3
Ensembl Gene ENSMUSG00000031284
Gene Name p21 (RAC1) activated kinase 3
Synonyms PAK-3
MMRRC Submission 040760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock # R3801 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 143518591-143797796 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 143709731 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 87 (V87I)
Ref Sequence ENSEMBL: ENSMUSP00000118716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033640] [ENSMUST00000112863] [ENSMUST00000112864] [ENSMUST00000112865] [ENSMUST00000112868] [ENSMUST00000134402] [ENSMUST00000155215] [ENSMUST00000156449] [ENSMUST00000172330]
AlphaFold Q61036
Predicted Effect probably benign
Transcript: ENSMUST00000033640
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033640
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112863
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108484
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112864
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108485
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112865
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108486
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112868
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108489
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134402
AA Change: V87I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119090
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 2.49e-9 SMART
Pfam:PBD 124 163 2e-9 PFAM
low complexity region 208 225 N/A INTRINSIC
Pfam:Pkinase 304 366 4e-10 PFAM
Pfam:Pkinase_Tyr 304 366 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155215
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118549
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156449
AA Change: V87I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118716
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172330
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126562
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Meta Mutation Damage Score 0.1486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase and forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of non-syndromic mental retardation X-linked type 30 (MRX30), also called X-linked mental retardation type 47 (MRX47). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for one knock-out allele display a selective impairment in hippocampal late-phase long-term potentiation, and deficits in learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
Als2 A C 1: 59,167,199 M1634R probably damaging Het
Ankfy1 T C 11: 72,749,420 S531P probably benign Het
Atp6v1e1 A G 6: 120,801,059 Y172H probably benign Het
Brd1 C T 15: 88,717,040 V464M probably damaging Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Cacnb2 A G 2: 14,824,263 D3G possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Cgrrf1 G T 14: 46,832,363 G30C probably damaging Het
Crnkl1 T C 2: 145,919,795 D614G probably benign Het
Cyp2c23 C T 19: 44,007,039 V430I probably benign Het
Dazl G A 17: 50,281,281 R289W probably benign Het
Dsg1b C T 18: 20,390,203 P96S probably damaging Het
Dusp14 A G 11: 84,048,709 S169P possibly damaging Het
Egfem1 A G 3: 29,151,926 D91G probably benign Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Fap C T 2: 62,546,650 V191I probably benign Het
Flnc T C 6: 29,447,404 Y1069H probably damaging Het
Fndc7 T C 3: 108,869,148 T526A possibly damaging Het
Fras1 A T 5: 96,733,932 T2508S probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Hyal5 A T 6: 24,876,524 H132L probably benign Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Lrrk2 A G 15: 91,737,111 R963G probably benign Het
Lrtm2 G A 6: 119,317,483 T229I probably damaging Het
Mb21d2 A T 16: 28,828,003 D406E possibly damaging Het
Meikin T A 11: 54,399,871 probably null Het
Mybl1 A T 1: 9,673,214 F538I probably damaging Het
Nectin2 T C 7: 19,717,636 D491G probably benign Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nid2 T C 14: 19,809,997 C1328R probably damaging Het
Nlrp1a T A 11: 71,122,703 M574L probably benign Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Nrg3 G A 14: 38,376,434 P496S probably damaging Het
Olfr1287 A T 2: 111,449,565 I142F probably benign Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prdm12 A G 2: 31,651,947 K223E probably damaging Het
Prkd1 C A 12: 50,383,422 R634L possibly damaging Het
Rassf3 T A 10: 121,414,366 I181F possibly damaging Het
Samd8 G A 14: 21,775,065 V30M probably damaging Het
Sema4f A T 6: 82,918,627 H308Q possibly damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slpi A G 2: 164,356,238 L12P probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Spag17 A G 3: 100,053,853 K985R possibly damaging Het
Stc1 T C 14: 69,038,475 I239T probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Tmed4 C A 11: 6,274,233 V80F probably damaging Het
Tnpo2 T A 8: 85,055,171 probably null Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Triobp A T 15: 78,973,700 Q1167L probably benign Het
Txndc16 G A 14: 45,151,352 P536L possibly damaging Het
Usp13 C T 3: 32,881,508 A360V possibly damaging Het
Vhl G A 6: 113,629,462 V147I probably benign Het
Vldlr A T 19: 27,217,621 T3S probably damaging Het
Vps54 T A 11: 21,268,832 D130E probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zfp87 A T 13: 67,521,215 N37K probably damaging Het
Other mutations in Pak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Pak3 APN X 143789333 missense probably damaging 1.00
wolfpack UTSW X 143733209 splice site probably null
R0464:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0583:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0586:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0587:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0781:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0908:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1029:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1917:Pak3 UTSW X 143791302 missense possibly damaging 0.94
R2918:Pak3 UTSW X 143764976 missense probably damaging 1.00
R3802:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3803:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3804:Pak3 UTSW X 143709731 missense probably damaging 1.00
R4326:Pak3 UTSW X 143733209 splice site probably null
R4328:Pak3 UTSW X 143733209 splice site probably null
R4329:Pak3 UTSW X 143733209 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTCCATGTACTTGTCAGTAAGG -3'
(R):5'- GGCAGGGTCTCCTTAGCATAAC -3'

Sequencing Primer
(F):5'- TGTACATACCAGAAAACGATGAGTC -3'
(R):5'- AGCATAACTACATTTTCTGTGCC -3'
Posted On 2015-03-25