Incidental Mutation 'R3767:Agmat'
ID273045
Institutional Source Beutler Lab
Gene Symbol Agmat
Ensembl Gene ENSMUSG00000040706
Gene Nameagmatine ureohydrolase (agmatinase)
Synonyms5033405N08Rik
MMRRC Submission 040744-MU
Accession Numbers

Genbank: NM_001081408; MGI: 1923236

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3767 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141746672-141759263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141755962 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000040853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014] [ENSMUST00000038161]
Predicted Effect probably benign
Transcript: ENSMUST00000038014
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038161
AA Change: T236A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040853
Gene: ENSMUSG00000040706
AA Change: T236A

DomainStartEndE-ValueType
low complexity region 44 62 N/A INTRINSIC
Pfam:Arginase 77 351 9.8e-85 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 23,157,188 V134E possibly damaging Het
Anxa9 T C 3: 95,301,114 N197S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Axdnd1 G A 1: 156,380,858 T470M probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cdh3 A T 8: 106,536,974 probably null Het
Cep85l A T 10: 53,291,810 I624K probably benign Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Dchs1 A T 7: 105,757,085 D2313E possibly damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exo1 C T 1: 175,886,746 P73L probably damaging Het
Fgfrl1 C A 5: 108,705,376 H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 G135D probably damaging Het
Herc3 G A 6: 58,862,988 R362H probably benign Het
Herc3 T C 6: 58,876,602 F583L probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Ighv1-54 A G 12: 115,193,976 V17A possibly damaging Het
Kcnh5 A G 12: 75,087,576 Y400H possibly damaging Het
Kcnk16 T A 14: 20,269,162 M1L possibly damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lonp1 T C 17: 56,621,952 E270G possibly damaging Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mrc1 A G 2: 14,319,170 Y1106C probably damaging Het
Mybpc1 G T 10: 88,570,659 probably null Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Nlrp4e G T 7: 23,340,563 L770F probably damaging Het
Npas3 A G 12: 54,069,074 *895W probably null Het
Nphs2 T C 1: 156,313,038 I115T probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr936 T A 9: 39,047,411 H47L unknown Het
Patj A T 4: 98,681,219 K1128* probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ppp1r13b G T 12: 111,846,417 R123S probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Pum2 T A 12: 8,719,076 Y323* probably null Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Selenoi A G 5: 30,256,189 Y141C probably damaging Het
Smcr8 A G 11: 60,779,504 T493A probably benign Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc23l T A 15: 10,530,695 Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdr1 C T 5: 38,540,539 G228R probably damaging Het
Xab2 T C 8: 3,619,053 N31S probably damaging Het
Other mutations in Agmat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02870:Agmat APN 4 141746942 missense probably benign 0.02
3-1:Agmat UTSW 4 141749582 missense probably damaging 1.00
3-1:Agmat UTSW 4 141749610 missense possibly damaging 0.49
R1635:Agmat UTSW 4 141747069 missense probably damaging 1.00
R2103:Agmat UTSW 4 141755903 missense probably damaging 0.97
R2215:Agmat UTSW 4 141749588 missense probably benign 0.01
R4379:Agmat UTSW 4 141757491 missense probably benign 0.10
R5422:Agmat UTSW 4 141755833 missense probably damaging 1.00
R5640:Agmat UTSW 4 141755823 missense probably damaging 1.00
R5750:Agmat UTSW 4 141749687 missense probably benign 0.03
R6728:Agmat UTSW 4 141749586 missense probably benign 0.00
R6891:Agmat UTSW 4 141755881 missense probably benign 0.01
R7293:Agmat UTSW 4 141755935 nonsense probably null
R7298:Agmat UTSW 4 141746964 missense possibly damaging 0.90
R7361:Agmat UTSW 4 141746852 missense probably benign 0.23
R7585:Agmat UTSW 4 141749745 missense probably benign 0.09
Z1177:Agmat UTSW 4 141746979 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACCTCTGAGATGCCGTTTTC -3'
(R):5'- TCTTGCCACATGAGTCACTTG -3'

Sequencing Primer
(F):5'- GAGAAGGTCTACCATCGG -3'
(R):5'- CTGGGAATCAAACTCAGGTTCTC -3'
Posted On2015-03-25