Incidental Mutation 'R3767:Herc3'
ID 273051
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Name hect domain and RLD 3
Synonyms 5730409F18Rik
MMRRC Submission 040744-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3767 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 58808450-58897383 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58853587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 583 (F583L)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401]
AlphaFold A6H6S0
Predicted Effect probably benign
Transcript: ENSMUST00000031823
AA Change: F583L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: F583L

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041401
AA Change: F583L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: F583L

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204196
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 22,975,938 (GRCm39) V134E possibly damaging Het
Agmat A G 4: 141,483,273 (GRCm39) T236A probably benign Het
Anxa9 T C 3: 95,208,425 (GRCm39) N197S probably benign Het
Arhgap23 A T 11: 97,366,932 (GRCm39) D1071V probably damaging Het
Axdnd1 G A 1: 156,208,428 (GRCm39) T470M probably damaging Het
C3 C T 17: 57,512,303 (GRCm39) D1542N possibly damaging Het
Cdh3 A T 8: 107,263,606 (GRCm39) probably null Het
Cep85l A T 10: 53,167,906 (GRCm39) I624K probably benign Het
Cplx4 T C 18: 66,102,998 (GRCm39) T41A probably benign Het
Dchs1 A T 7: 105,406,292 (GRCm39) D2313E possibly damaging Het
Dock7 T C 4: 98,859,066 (GRCm39) T1409A probably benign Het
Exo1 C T 1: 175,714,312 (GRCm39) P73L probably damaging Het
Fgfrl1 C A 5: 108,853,242 (GRCm39) H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 (GRCm39) G135D probably damaging Het
Ifna7 T C 4: 88,734,964 (GRCm39) V167A probably damaging Het
Ighv1-54 A G 12: 115,157,596 (GRCm39) V17A possibly damaging Het
Kcnh5 A G 12: 75,134,350 (GRCm39) Y400H possibly damaging Het
Kcnk16 T A 14: 20,319,230 (GRCm39) M1L possibly damaging Het
Kctd19 T C 8: 106,123,112 (GRCm39) T101A probably benign Het
Klf3 A G 5: 64,984,560 (GRCm39) probably null Het
Krtap12-1 G T 10: 77,556,729 (GRCm39) V91L probably benign Het
Lonp1 T C 17: 56,928,952 (GRCm39) E270G possibly damaging Het
Mgl2 T C 11: 70,026,659 (GRCm39) L128P probably damaging Het
Mrc1 A G 2: 14,323,981 (GRCm39) Y1106C probably damaging Het
Mybpc1 G T 10: 88,406,521 (GRCm39) probably null Het
Mypn C A 10: 62,961,486 (GRCm39) L1035F possibly damaging Het
Neurl1a T C 19: 47,228,328 (GRCm39) L58P probably damaging Het
Nlrp4e G T 7: 23,039,988 (GRCm39) L770F probably damaging Het
Npas3 A G 12: 54,115,857 (GRCm39) *895W probably null Het
Nphs2 T C 1: 156,140,608 (GRCm39) I115T probably damaging Het
Or1ad6 A G 11: 50,860,385 (GRCm39) D180G probably damaging Het
Or8g22 T A 9: 38,958,707 (GRCm39) H47L unknown Het
Patj A T 4: 98,569,456 (GRCm39) K1128* probably null Het
Pla2g5 C G 4: 138,528,746 (GRCm39) C70S probably damaging Het
Pole4 G A 6: 82,599,095 (GRCm39) R119C possibly damaging Het
Ppm1h G T 10: 122,740,027 (GRCm39) L367F probably damaging Het
Ppp1r13b G T 12: 111,812,851 (GRCm39) R123S probably damaging Het
Ptpru C T 4: 131,535,735 (GRCm39) C414Y probably damaging Het
Pum2 T A 12: 8,769,076 (GRCm39) Y323* probably null Het
Rhot2 T C 17: 26,059,521 (GRCm39) D407G probably benign Het
Rreb1 C T 13: 38,113,579 (GRCm39) R313W possibly damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scn11a T A 9: 119,613,115 (GRCm39) D825V probably damaging Het
Selenoi A G 5: 30,461,187 (GRCm39) Y141C probably damaging Het
Smcr8 A G 11: 60,670,330 (GRCm39) T493A probably benign Het
Tjp2 A T 19: 24,078,190 (GRCm39) I901N probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ttc23l T A 15: 10,530,781 (GRCm39) Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Wdr1 C T 5: 38,697,882 (GRCm39) G228R probably damaging Het
Xab2 T C 8: 3,669,053 (GRCm39) N31S probably damaging Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58,851,248 (GRCm39) missense probably damaging 1.00
IGL00423:Herc3 APN 6 58,845,700 (GRCm39) missense probably damaging 0.99
IGL00468:Herc3 APN 6 58,895,751 (GRCm39) missense probably benign 0.04
IGL01153:Herc3 APN 6 58,837,321 (GRCm39) missense probably benign 0.21
IGL01468:Herc3 APN 6 58,831,880 (GRCm39) missense probably benign 0.00
IGL01696:Herc3 APN 6 58,837,371 (GRCm39) missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58,893,561 (GRCm39) missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58,845,679 (GRCm39) missense probably benign
IGL02953:Herc3 APN 6 58,834,718 (GRCm39) nonsense probably null
aegean UTSW 6 58,832,745 (GRCm39) nonsense probably null
PIT4519001:Herc3 UTSW 6 58,853,796 (GRCm39) missense probably damaging 1.00
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0268:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0334:Herc3 UTSW 6 58,895,802 (GRCm39) missense probably damaging 1.00
R0344:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0853:Herc3 UTSW 6 58,853,549 (GRCm39) missense probably damaging 1.00
R0927:Herc3 UTSW 6 58,845,748 (GRCm39) missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58,864,478 (GRCm39) missense probably damaging 1.00
R1432:Herc3 UTSW 6 58,893,827 (GRCm39) missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58,853,500 (GRCm39) nonsense probably null
R1594:Herc3 UTSW 6 58,864,569 (GRCm39) unclassified probably benign
R1757:Herc3 UTSW 6 58,893,455 (GRCm39) missense probably damaging 1.00
R1765:Herc3 UTSW 6 58,865,645 (GRCm39) missense probably damaging 0.99
R1932:Herc3 UTSW 6 58,853,778 (GRCm39) missense probably damaging 0.99
R1945:Herc3 UTSW 6 58,864,424 (GRCm39) missense probably damaging 0.96
R1988:Herc3 UTSW 6 58,861,960 (GRCm39) critical splice donor site probably null
R2172:Herc3 UTSW 6 58,864,422 (GRCm39) missense probably damaging 1.00
R3080:Herc3 UTSW 6 58,833,631 (GRCm39) splice site probably null
R3545:Herc3 UTSW 6 58,833,670 (GRCm39) missense probably damaging 1.00
R3767:Herc3 UTSW 6 58,839,973 (GRCm39) missense probably benign
R3805:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R3806:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R4049:Herc3 UTSW 6 58,853,822 (GRCm39) missense probably damaging 0.99
R4250:Herc3 UTSW 6 58,893,501 (GRCm39) missense probably damaging 1.00
R4469:Herc3 UTSW 6 58,853,794 (GRCm39) nonsense probably null
R4534:Herc3 UTSW 6 58,837,332 (GRCm39) missense probably benign
R4573:Herc3 UTSW 6 58,871,098 (GRCm39) missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58,864,484 (GRCm39) missense probably damaging 1.00
R5047:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5049:Herc3 UTSW 6 58,871,524 (GRCm39) splice site probably null
R5062:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5063:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5288:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5297:Herc3 UTSW 6 58,833,626 (GRCm39) missense probably damaging 1.00
R5386:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5435:Herc3 UTSW 6 58,832,791 (GRCm39) missense probably damaging 1.00
R5576:Herc3 UTSW 6 58,865,710 (GRCm39) missense probably benign 0.08
R5605:Herc3 UTSW 6 58,834,712 (GRCm39) missense probably damaging 1.00
R5719:Herc3 UTSW 6 58,871,528 (GRCm39) missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58,895,784 (GRCm39) missense probably benign 0.12
R5870:Herc3 UTSW 6 58,893,435 (GRCm39) missense probably benign 0.01
R6460:Herc3 UTSW 6 58,867,108 (GRCm39) missense probably damaging 1.00
R6930:Herc3 UTSW 6 58,893,444 (GRCm39) missense probably damaging 0.98
R7034:Herc3 UTSW 6 58,853,840 (GRCm39) missense probably benign 0.00
R7131:Herc3 UTSW 6 58,864,409 (GRCm39) missense probably damaging 1.00
R7187:Herc3 UTSW 6 58,833,616 (GRCm39) missense probably benign 0.42
R7212:Herc3 UTSW 6 58,895,758 (GRCm39) missense probably damaging 1.00
R7335:Herc3 UTSW 6 58,853,773 (GRCm39) missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58,835,971 (GRCm39) missense probably benign
R7568:Herc3 UTSW 6 58,820,795 (GRCm39) missense probably benign 0.01
R7857:Herc3 UTSW 6 58,820,637 (GRCm39) nonsense probably null
R8321:Herc3 UTSW 6 58,820,754 (GRCm39) missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58,850,786 (GRCm39) missense probably damaging 0.96
R8684:Herc3 UTSW 6 58,864,561 (GRCm39) missense probably damaging 1.00
R8968:Herc3 UTSW 6 58,867,183 (GRCm39) missense probably damaging 1.00
R8994:Herc3 UTSW 6 58,851,328 (GRCm39) missense probably benign 0.11
R9219:Herc3 UTSW 6 58,871,552 (GRCm39) missense probably benign 0.01
R9434:Herc3 UTSW 6 58,853,846 (GRCm39) missense probably benign 0.00
R9562:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
R9565:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
Z1176:Herc3 UTSW 6 58,820,843 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTAAGAACACTTGTCCAGGG -3'
(R):5'- GTCCACAAGACTAGAAATCTCAGGG -3'

Sequencing Primer
(F):5'- CCAGGGTTATGTGCTAAGACATGTC -3'
(R):5'- GCTTCACCTTAAGATTTACCTGGTG -3'
Posted On 2015-03-25