Incidental Mutation 'R3767:Scn11a'
ID273061
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 040744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3767 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119784049 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 825 (D825V)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: D825V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: D825V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: D825V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 23,157,188 V134E possibly damaging Het
Agmat A G 4: 141,755,962 T236A probably benign Het
Anxa9 T C 3: 95,301,114 N197S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Axdnd1 G A 1: 156,380,858 T470M probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cdh3 A T 8: 106,536,974 probably null Het
Cep85l A T 10: 53,291,810 I624K probably benign Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Dchs1 A T 7: 105,757,085 D2313E possibly damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exo1 C T 1: 175,886,746 P73L probably damaging Het
Fgfrl1 C A 5: 108,705,376 H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 G135D probably damaging Het
Herc3 G A 6: 58,862,988 R362H probably benign Het
Herc3 T C 6: 58,876,602 F583L probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Ighv1-54 A G 12: 115,193,976 V17A possibly damaging Het
Kcnh5 A G 12: 75,087,576 Y400H possibly damaging Het
Kcnk16 T A 14: 20,269,162 M1L possibly damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lonp1 T C 17: 56,621,952 E270G possibly damaging Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mrc1 A G 2: 14,319,170 Y1106C probably damaging Het
Mybpc1 G T 10: 88,570,659 probably null Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Nlrp4e G T 7: 23,340,563 L770F probably damaging Het
Npas3 A G 12: 54,069,074 *895W probably null Het
Nphs2 T C 1: 156,313,038 I115T probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr936 T A 9: 39,047,411 H47L unknown Het
Patj A T 4: 98,681,219 K1128* probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ppp1r13b G T 12: 111,846,417 R123S probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Pum2 T A 12: 8,719,076 Y323* probably null Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Selenoi A G 5: 30,256,189 Y141C probably damaging Het
Smcr8 A G 11: 60,779,504 T493A probably benign Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc23l T A 15: 10,530,695 Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdr1 C T 5: 38,540,539 G228R probably damaging Het
Xab2 T C 8: 3,619,053 N31S probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGTGTACAGAGTCATTTC -3'
(R):5'- AGCAGGAAGTCTCGTTTGACTAG -3'

Sequencing Primer
(F):5'- CCAGTGTACAGAGTCATTTCTGAATC -3'
(R):5'- AAGTCTCGTTTGACTAGGTTGAGC -3'
Posted On2015-03-25