Incidental Mutation 'R3767:Mypn'
ID273065
Institutional Source Beutler Lab
Gene Symbol Mypn
Ensembl Gene ENSMUSG00000020067
Gene Namemyopalladin
Synonyms1110056A04Rik
MMRRC Submission 040744-MU
Accession Numbers

Genbank: NM_182992; MGI: 1916052

Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R3767 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63115795-63203952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63125707 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1035 (L1035F)
Ref Sequence ENSEMBL: ENSMUSP00000093240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095580] [ENSMUST00000218978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095580
AA Change: L1035F

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067
AA Change: L1035F

DomainStartEndE-ValueType
low complexity region 46 56 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
IGc2 279 346 2.16e-8 SMART
low complexity region 384 405 N/A INTRINSIC
IGc2 444 519 1.69e-10 SMART
low complexity region 636 648 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 721 741 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 826 838 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
IGc2 953 1022 1.64e-8 SMART
IGc2 1080 1148 3.67e-11 SMART
IG 1173 1259 1.17e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218978
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 23,157,188 V134E possibly damaging Het
Agmat A G 4: 141,755,962 T236A probably benign Het
Anxa9 T C 3: 95,301,114 N197S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Axdnd1 G A 1: 156,380,858 T470M probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cdh3 A T 8: 106,536,974 probably null Het
Cep85l A T 10: 53,291,810 I624K probably benign Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Dchs1 A T 7: 105,757,085 D2313E possibly damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exo1 C T 1: 175,886,746 P73L probably damaging Het
Fgfrl1 C A 5: 108,705,376 H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 G135D probably damaging Het
Herc3 G A 6: 58,862,988 R362H probably benign Het
Herc3 T C 6: 58,876,602 F583L probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Ighv1-54 A G 12: 115,193,976 V17A possibly damaging Het
Kcnh5 A G 12: 75,087,576 Y400H possibly damaging Het
Kcnk16 T A 14: 20,269,162 M1L possibly damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lonp1 T C 17: 56,621,952 E270G possibly damaging Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mrc1 A G 2: 14,319,170 Y1106C probably damaging Het
Mybpc1 G T 10: 88,570,659 probably null Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Nlrp4e G T 7: 23,340,563 L770F probably damaging Het
Npas3 A G 12: 54,069,074 *895W probably null Het
Nphs2 T C 1: 156,313,038 I115T probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr936 T A 9: 39,047,411 H47L unknown Het
Patj A T 4: 98,681,219 K1128* probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ppp1r13b G T 12: 111,846,417 R123S probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Pum2 T A 12: 8,719,076 Y323* probably null Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Selenoi A G 5: 30,256,189 Y141C probably damaging Het
Smcr8 A G 11: 60,779,504 T493A probably benign Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc23l T A 15: 10,530,695 Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdr1 C T 5: 38,540,539 G228R probably damaging Het
Xab2 T C 8: 3,619,053 N31S probably damaging Het
Other mutations in Mypn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mypn APN 10 63192423 missense probably damaging 1.00
IGL01137:Mypn APN 10 63152854 missense probably benign 0.12
IGL01383:Mypn APN 10 63135797 missense probably damaging 1.00
IGL01560:Mypn APN 10 63134964 missense probably benign 0.27
IGL01569:Mypn APN 10 63127759 missense probably damaging 1.00
IGL02197:Mypn APN 10 63123278 missense possibly damaging 0.69
IGL02829:Mypn APN 10 63192586 missense probably benign 0.01
IGL03221:Mypn APN 10 63131123 missense probably damaging 1.00
IGL03377:Mypn APN 10 63192865 missense probably benign 0.01
2107:Mypn UTSW 10 63203751 utr 5 prime probably benign
PIT4576001:Mypn UTSW 10 63120071 missense probably damaging 1.00
R0115:Mypn UTSW 10 63192380 splice site probably benign
R0377:Mypn UTSW 10 63127622 unclassified probably benign
R0480:Mypn UTSW 10 63193203 missense probably benign 0.01
R0581:Mypn UTSW 10 63162244 missense probably benign 0.06
R0669:Mypn UTSW 10 63134923 splice site probably benign
R0822:Mypn UTSW 10 63169256 missense probably damaging 1.00
R1209:Mypn UTSW 10 63118499 missense probably damaging 1.00
R1401:Mypn UTSW 10 63152857 missense probably damaging 0.96
R1513:Mypn UTSW 10 63169368 missense probably damaging 0.99
R1750:Mypn UTSW 10 63136197 missense probably benign 0.01
R1780:Mypn UTSW 10 63121964 missense probably damaging 1.00
R1791:Mypn UTSW 10 63125693 missense probably damaging 0.97
R1859:Mypn UTSW 10 63146190 missense probably benign
R1903:Mypn UTSW 10 63123397 missense probably benign 0.06
R2275:Mypn UTSW 10 63131069 missense probably damaging 1.00
R2420:Mypn UTSW 10 63192869 nonsense probably null
R3425:Mypn UTSW 10 63118417 splice site probably benign
R3768:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3770:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3777:Mypn UTSW 10 63147982 missense possibly damaging 0.92
R3785:Mypn UTSW 10 63193182 missense probably benign 0.43
R3888:Mypn UTSW 10 63192510 missense probably damaging 1.00
R4289:Mypn UTSW 10 63131182 missense probably damaging 1.00
R4301:Mypn UTSW 10 63118484 missense probably damaging 1.00
R4366:Mypn UTSW 10 63192708 missense probably benign 0.00
R4459:Mypn UTSW 10 63192432 missense probably damaging 1.00
R4921:Mypn UTSW 10 63147936 missense possibly damaging 0.75
R4995:Mypn UTSW 10 63119968 intron probably null
R5064:Mypn UTSW 10 63123371 missense possibly damaging 0.68
R5083:Mypn UTSW 10 63118528 missense probably damaging 0.98
R5108:Mypn UTSW 10 63136294 missense probably damaging 1.00
R5399:Mypn UTSW 10 63120186 missense probably benign 0.03
R5438:Mypn UTSW 10 63135839 nonsense probably null
R5590:Mypn UTSW 10 63120048 missense probably benign 0.27
R5652:Mypn UTSW 10 63135801 missense probably damaging 1.00
R5717:Mypn UTSW 10 63127776 missense probably damaging 1.00
R5970:Mypn UTSW 10 63131023 missense probably benign 0.36
R6616:Mypn UTSW 10 63169312 missense probably damaging 1.00
R6930:Mypn UTSW 10 63116939 missense probably damaging 1.00
R6987:Mypn UTSW 10 63193131 missense probably benign 0.00
R7020:Mypn UTSW 10 63192510 missense probably damaging 1.00
R7081:Mypn UTSW 10 63134958 missense probably damaging 1.00
R7477:Mypn UTSW 10 63125721 missense possibly damaging 0.89
R7534:Mypn UTSW 10 63193131 missense probably benign 0.00
X0022:Mypn UTSW 10 63136063 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGGCAGAACACCAATGC -3'
(R):5'- TGAACACAGAAAGTCTATTCGTTG -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- GTTTTGGCGGAGATAACAC -3'
Posted On2015-03-25