Incidental Mutation 'R3767:Olfr1378'
ID273071
Institutional Source Beutler Lab
Gene Symbol Olfr1378
Ensembl Gene ENSMUSG00000050343
Gene Nameolfactory receptor 1378
SynonymsGA_x6K02T2QP88-4469162-4468215, MOR129-2
MMRRC Submission 040744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3767 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50966530-50973113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50969558 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 180 (D180G)
Ref Sequence ENSEMBL: ENSMUSP00000149432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052285] [ENSMUST00000213259]
Predicted Effect probably damaging
Transcript: ENSMUST00000052285
AA Change: D180G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058119
Gene: ENSMUSG00000050343
AA Change: D180G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.1e-54 PFAM
Pfam:7tm_1 41 289 1.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213259
AA Change: D180G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 23,157,188 V134E possibly damaging Het
Agmat A G 4: 141,755,962 T236A probably benign Het
Anxa9 T C 3: 95,301,114 N197S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Axdnd1 G A 1: 156,380,858 T470M probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cdh3 A T 8: 106,536,974 probably null Het
Cep85l A T 10: 53,291,810 I624K probably benign Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Dchs1 A T 7: 105,757,085 D2313E possibly damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exo1 C T 1: 175,886,746 P73L probably damaging Het
Fgfrl1 C A 5: 108,705,376 H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 G135D probably damaging Het
Herc3 G A 6: 58,862,988 R362H probably benign Het
Herc3 T C 6: 58,876,602 F583L probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Ighv1-54 A G 12: 115,193,976 V17A possibly damaging Het
Kcnh5 A G 12: 75,087,576 Y400H possibly damaging Het
Kcnk16 T A 14: 20,269,162 M1L possibly damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lonp1 T C 17: 56,621,952 E270G possibly damaging Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mrc1 A G 2: 14,319,170 Y1106C probably damaging Het
Mybpc1 G T 10: 88,570,659 probably null Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Nlrp4e G T 7: 23,340,563 L770F probably damaging Het
Npas3 A G 12: 54,069,074 *895W probably null Het
Nphs2 T C 1: 156,313,038 I115T probably damaging Het
Olfr936 T A 9: 39,047,411 H47L unknown Het
Patj A T 4: 98,681,219 K1128* probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ppp1r13b G T 12: 111,846,417 R123S probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Pum2 T A 12: 8,719,076 Y323* probably null Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Selenoi A G 5: 30,256,189 Y141C probably damaging Het
Smcr8 A G 11: 60,779,504 T493A probably benign Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc23l T A 15: 10,530,695 Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdr1 C T 5: 38,540,539 G228R probably damaging Het
Xab2 T C 8: 3,619,053 N31S probably damaging Het
Other mutations in Olfr1378
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Olfr1378 APN 11 50969119 missense probably benign 0.00
PIT4243001:Olfr1378 UTSW 11 50969552 missense probably damaging 1.00
R0540:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0607:Olfr1378 UTSW 11 50969843 missense possibly damaging 0.96
R0699:Olfr1378 UTSW 11 50969818 missense probably damaging 1.00
R0719:Olfr1378 UTSW 11 50969934 nonsense probably null
R2117:Olfr1378 UTSW 11 50969320 missense probably damaging 0.98
R2263:Olfr1378 UTSW 11 50969869 missense possibly damaging 0.75
R3402:Olfr1378 UTSW 11 50969068 missense probably benign
R3768:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R3769:Olfr1378 UTSW 11 50969558 missense probably damaging 1.00
R4293:Olfr1378 UTSW 11 50969426 missense probably damaging 1.00
R4409:Olfr1378 UTSW 11 50969396 missense probably damaging 1.00
R4446:Olfr1378 UTSW 11 50969863 missense probably damaging 1.00
R4731:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4732:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R4733:Olfr1378 UTSW 11 50969266 missense possibly damaging 0.78
R5437:Olfr1378 UTSW 11 50969108 missense probably benign 0.02
R6085:Olfr1378 UTSW 11 50969123 missense probably damaging 1.00
R6648:Olfr1378 UTSW 11 50969173 missense probably damaging 1.00
R7419:Olfr1378 UTSW 11 50969325 nonsense probably null
R7686:Olfr1378 UTSW 11 50969755 missense possibly damaging 0.92
R8440:Olfr1378 UTSW 11 50969197 missense probably damaging 1.00
X0011:Olfr1378 UTSW 11 50969654 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACATGGATGGCTTCCTCCTG -3'
(R):5'- CCCACAAGTAGACAGGGCTTTC -3'

Sequencing Primer
(F):5'- GATGGCCTATGACCGCTATG -3'
(R):5'- AAGTAGACAGGGCTTTCCTTATTCC -3'
Posted On2015-03-25