Mutagenetix > Incidental Mutation

Incidental Mutation 'R3767:Arhgap23'

273074

Institutional Source

Beutler Lab

Gene Symbol

Arhgap23

Ensembl Gene

ENSMUSG00000049807

Gene Name

Rho GTPase activating protein 23

Synonyms

MMRRC Submission

040744-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3767 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97415533-97502402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 97476106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1071 (D1071V)

Ref Sequence

ENSEMBL: ENSMUSP00000112999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107601
AA Change: D860V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: D860V

Domain	Start	End	E-Value	Type
low complexity region	246	258	N/A	INTRINSIC
low complexity region	354	369	N/A	INTRINSIC
low complexity region	426	443	N/A	INTRINSIC
PH	479	600	3.2e-12	SMART
low complexity region	679	687	N/A	INTRINSIC
RhoGAP	707	884	6.83e-65	SMART
low complexity region	1051	1066	N/A	INTRINSIC
low complexity region	1101	1114	N/A	INTRINSIC
low complexity region	1125	1146	N/A	INTRINSIC
low complexity region	1176	1194	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121799
AA Change: D1071V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: D1071V

Domain	Start	End	E-Value	Type
low complexity region	8	29	N/A	INTRINSIC
PDZ	52	160	4.2e-17	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	565	580	N/A	INTRINSIC
low complexity region	637	654	N/A	INTRINSIC
PH	690	811	3.2e-12	SMART
low complexity region	890	898	N/A	INTRINSIC
RhoGAP	918	1095	6.83e-65	SMART
low complexity region	1262	1277	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
low complexity region	1336	1357	N/A	INTRINSIC
low complexity region	1387	1405	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142465
AA Change: D560V

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807
AA Change: D560V

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
low complexity region	126	143	N/A	INTRINSIC
PH	179	300	3.2e-12	SMART
low complexity region	379	387	N/A	INTRINSIC
RhoGAP	407	584	6.83e-65	SMART

Meta Mutation Damage Score

0.2889

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adipoq	T	A	16: 23,157,188	V134E	possibly damaging	Het
Agmat	A	G	4: 141,755,962	T236A	probably benign	Het
Anxa9	T	C	3: 95,301,114	N197S	probably benign	Het
Axdnd1	G	A	1: 156,380,858	T470M	probably damaging	Het
C3	C	T	17: 57,205,303	D1542N	possibly damaging	Het
Cdh3	A	T	8: 106,536,974		probably null	Het
Cep85l	A	T	10: 53,291,810	I624K	probably benign	Het
Cplx4	T	C	18: 65,969,927	T41A	probably benign	Het
Dchs1	A	T	7: 105,757,085	D2313E	possibly damaging	Het
Dock7	T	C	4: 98,970,829	T1409A	probably benign	Het
Exo1	C	T	1: 175,886,746	P73L	probably damaging	Het
Fgfrl1	C	A	5: 108,705,376	H197Q	possibly damaging	Het
Fsbp	G	A	4: 11,583,706	G135D	probably damaging	Het
Herc3	G	A	6: 58,862,988	R362H	probably benign	Het
Herc3	T	C	6: 58,876,602	F583L	probably benign	Het
Ifna7	T	C	4: 88,816,727	V167A	probably damaging	Het
Ighv1-54	A	G	12: 115,193,976	V17A	possibly damaging	Het
Kcnh5	A	G	12: 75,087,576	Y400H	possibly damaging	Het
Kcnk16	T	A	14: 20,269,162	M1L	possibly damaging	Het
Kctd19	T	C	8: 105,396,480	T101A	probably benign	Het
Klf3	A	G	5: 64,827,217		probably null	Het
Krtap12-1	G	T	10: 77,720,895	V91L	probably benign	Het
Lonp1	T	C	17: 56,621,952	E270G	possibly damaging	Het
Mgl2	T	C	11: 70,135,833	L128P	probably damaging	Het
Mrc1	A	G	2: 14,319,170	Y1106C	probably damaging	Het
Mybpc1	G	T	10: 88,570,659		probably null	Het
Mypn	C	A	10: 63,125,707	L1035F	possibly damaging	Het
Neurl1a	T	C	19: 47,239,889	L58P	probably damaging	Het
Nlrp4e	G	T	7: 23,340,563	L770F	probably damaging	Het
Npas3	A	G	12: 54,069,074	*895W	probably null	Het
Nphs2	T	C	1: 156,313,038	I115T	probably damaging	Het
Olfr1378	A	G	11: 50,969,558	D180G	probably damaging	Het
Olfr936	T	A	9: 39,047,411	H47L	unknown	Het
Patj	A	T	4: 98,681,219	K1128*	probably null	Het
Pla2g5	C	G	4: 138,801,435	C70S	probably damaging	Het
Pole4	G	A	6: 82,622,114	R119C	possibly damaging	Het
Ppm1h	G	T	10: 122,904,122	L367F	probably damaging	Het
Ppp1r13b	G	T	12: 111,846,417	R123S	probably damaging	Het
Ptpru	C	T	4: 131,808,424	C414Y	probably damaging	Het
Pum2	T	A	12: 8,719,076	Y323*	probably null	Het
Rhot2	T	C	17: 25,840,547	D407G	probably benign	Het
Rreb1	C	T	13: 37,929,603	R313W	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scn11a	T	A	9: 119,784,049	D825V	probably damaging	Het
Selenoi	A	G	5: 30,256,189	Y141C	probably damaging	Het
Smcr8	A	G	11: 60,779,504	T493A	probably benign	Het
Tjp2	A	T	19: 24,100,826	I901N	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ttc23l	T	A	15: 10,530,695	Y277F	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Wdr1	C	T	5: 38,540,539	G228R	probably damaging	Het
Xab2	T	C	8: 3,619,053	N31S	probably damaging	Het

Other mutations in Arhgap23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Arhgap23	APN	11	97492671	intron	probably benign
IGL00493:Arhgap23	APN	11	97446553	critical splice donor site	probably null
IGL01729:Arhgap23	APN	11	97453961	missense	probably damaging	1.00
IGL01805:Arhgap23	APN	11	97492602	intron	probably benign
IGL02005:Arhgap23	APN	11	97491219	missense	probably damaging	0.99
IGL02026:Arhgap23	APN	11	97451581	missense	probably damaging	0.99
IGL02135:Arhgap23	APN	11	97451702	missense	probably damaging	0.97
IGL02178:Arhgap23	APN	11	97452353	missense	probably benign	0.42
IGL02226:Arhgap23	APN	11	97451600	missense	probably benign	0.07
IGL02309:Arhgap23	APN	11	97466001	splice site	probably benign
IGL02399:Arhgap23	APN	11	97491005	intron	probably benign
IGL02630:Arhgap23	APN	11	97454297	missense	probably benign	0.24
IGL02724:Arhgap23	APN	11	97491179	missense	probably damaging	0.99
IGL02740:Arhgap23	APN	11	97475017	missense	probably damaging	1.00
IGL02746:Arhgap23	APN	11	97454204	splice site	probably benign
IGL02862:Arhgap23	APN	11	97456480	missense	probably damaging	1.00
IGL03380:Arhgap23	APN	11	97452518	missense	probably damaging	1.00
R0091:Arhgap23	UTSW	11	97452244	missense	probably benign	0.44
R0134:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0225:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0305:Arhgap23	UTSW	11	97501109	missense	probably damaging	0.99
R0358:Arhgap23	UTSW	11	97463588	missense	probably damaging	1.00
R0422:Arhgap23	UTSW	11	97463652	missense	probably damaging	1.00
R0497:Arhgap23	UTSW	11	97452163	missense	probably damaging	1.00
R0580:Arhgap23	UTSW	11	97446536	frame shift	probably null
R0782:Arhgap23	UTSW	11	97500554	missense	possibly damaging	0.73
R1216:Arhgap23	UTSW	11	97492672	intron	probably benign
R1488:Arhgap23	UTSW	11	97500859	missense	possibly damaging	0.53
R1785:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R1844:Arhgap23	UTSW	11	97463408	missense	probably damaging	1.00
R1855:Arhgap23	UTSW	11	97448697	missense	probably damaging	0.99
R1977:Arhgap23	UTSW	11	97451447	missense	possibly damaging	0.95
R2064:Arhgap23	UTSW	11	97493062	missense	probably benign	0.02
R2130:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R2431:Arhgap23	UTSW	11	97452404	missense	probably benign
R2853:Arhgap23	UTSW	11	97492594	splice site	probably null
R3768:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3769:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3770:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R4209:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R4247:Arhgap23	UTSW	11	97463699	missense	probably damaging	1.00
R4997:Arhgap23	UTSW	11	97452020	missense	probably damaging	0.98
R5399:Arhgap23	UTSW	11	97500917	missense	probably damaging	0.97
R5549:Arhgap23	UTSW	11	97466568	missense	probably damaging	0.96
R5655:Arhgap23	UTSW	11	97452546	critical splice donor site	probably null
R5857:Arhgap23	UTSW	11	97451579	missense	possibly damaging	0.93
R6013:Arhgap23	UTSW	11	97500992	missense	probably damaging	0.99
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6077:Arhgap23	UTSW	11	97491232	critical splice donor site	probably null
R6151:Arhgap23	UTSW	11	97500412	missense	probably benign	0.01
R6393:Arhgap23	UTSW	11	97463672	missense	probably damaging	0.98
R6693:Arhgap23	UTSW	11	97466517	missense	probably damaging	1.00
R6752:Arhgap23	UTSW	11	97452248	missense	probably damaging	0.98
R7202:Arhgap23	UTSW	11	97451993	missense	possibly damaging	0.65
R7209:Arhgap23	UTSW	11	97476085	missense	probably damaging	1.00
R7209:Arhgap23	UTSW	11	97492447	splice site	probably null
R7320:Arhgap23	UTSW	11	97451545	missense	probably benign	0.10
R7345:Arhgap23	UTSW	11	97466478	missense	possibly damaging	0.91
R7599:Arhgap23	UTSW	11	97500343	missense	probably benign
R8229:Arhgap23	UTSW	11	97453906	missense	probably benign	0.36
R8332:Arhgap23	UTSW	11	97491134	missense	unknown
R8412:Arhgap23	UTSW	11	97466028	missense	probably benign	0.02
R8460:Arhgap23	UTSW	11	97452371	missense	probably damaging	1.00
R8492:Arhgap23	UTSW	11	97475021	missense	probably damaging	1.00
R8525:Arhgap23	UTSW	11	97490084	missense	probably damaging	1.00
R8692:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R8708:Arhgap23	UTSW	11	97452412	missense	probably benign	0.06
R8749:Arhgap23	UTSW	11	97500815	missense	probably damaging	0.99
R8882:Arhgap23	UTSW	11	97465123	missense	probably benign	0.00
R9188:Arhgap23	UTSW	11	97500157	missense	possibly damaging	0.72
RF020:Arhgap23	UTSW	11	97463561	missense	probably damaging	1.00
V8831:Arhgap23	UTSW	11	97456545	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCATGTGAGATGTCTGACCC -3'
(R):5'- TTGATGGCAGCCTGTCACTG -3'

Sequencing Primer
(F):5'- CCACTCTAAGGACATGTCAGAGTTG -3'
(R):5'- CAGCCTGTCACTGCTGTG -3'

Posted On

2015-03-25