Incidental Mutation 'R3767:Npas3'
ID273076
Institutional Source Beutler Lab
Gene Symbol Npas3
Ensembl Gene ENSMUSG00000021010
Gene Nameneuronal PAS domain protein 3
Synonyms4930423H22Rik, bHLHe12
MMRRC Submission 040744-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R3767 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location53248677-54072175 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 54069074 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 895 (*895W)
Ref Sequence ENSEMBL: ENSMUSP00000152411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000223057] [ENSMUST00000223358]
Predicted Effect probably null
Transcript: ENSMUST00000101432
AA Change: *926W
SMART Domains Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: *926W

DomainStartEndE-ValueType
HLH 64 119 1.34e-6 SMART
PAS 154 220 8.69e-11 SMART
low complexity region 234 256 N/A INTRINSIC
PAS 326 392 7.4e-5 SMART
PAC 398 441 2.46e-1 SMART
low complexity region 461 477 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 598 627 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185390
Predicted Effect probably null
Transcript: ENSMUST00000223057
AA Change: *908W
Predicted Effect probably null
Transcript: ENSMUST00000223358
AA Change: *895W
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T A 16: 23,157,188 V134E possibly damaging Het
Agmat A G 4: 141,755,962 T236A probably benign Het
Anxa9 T C 3: 95,301,114 N197S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Axdnd1 G A 1: 156,380,858 T470M probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cdh3 A T 8: 106,536,974 probably null Het
Cep85l A T 10: 53,291,810 I624K probably benign Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Dchs1 A T 7: 105,757,085 D2313E possibly damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Exo1 C T 1: 175,886,746 P73L probably damaging Het
Fgfrl1 C A 5: 108,705,376 H197Q possibly damaging Het
Fsbp G A 4: 11,583,706 G135D probably damaging Het
Herc3 G A 6: 58,862,988 R362H probably benign Het
Herc3 T C 6: 58,876,602 F583L probably benign Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Ighv1-54 A G 12: 115,193,976 V17A possibly damaging Het
Kcnh5 A G 12: 75,087,576 Y400H possibly damaging Het
Kcnk16 T A 14: 20,269,162 M1L possibly damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lonp1 T C 17: 56,621,952 E270G possibly damaging Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mrc1 A G 2: 14,319,170 Y1106C probably damaging Het
Mybpc1 G T 10: 88,570,659 probably null Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Neurl1a T C 19: 47,239,889 L58P probably damaging Het
Nlrp4e G T 7: 23,340,563 L770F probably damaging Het
Nphs2 T C 1: 156,313,038 I115T probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr936 T A 9: 39,047,411 H47L unknown Het
Patj A T 4: 98,681,219 K1128* probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ppp1r13b G T 12: 111,846,417 R123S probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Pum2 T A 12: 8,719,076 Y323* probably null Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rreb1 C T 13: 37,929,603 R313W possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn11a T A 9: 119,784,049 D825V probably damaging Het
Selenoi A G 5: 30,256,189 Y141C probably damaging Het
Smcr8 A G 11: 60,779,504 T493A probably benign Het
Tjp2 A T 19: 24,100,826 I901N probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc23l T A 15: 10,530,695 Y277F possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdr1 C T 5: 38,540,539 G228R probably damaging Het
Xab2 T C 8: 3,619,053 N31S probably damaging Het
Other mutations in Npas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Npas3 APN 12 54003560 missense probably damaging 1.00
IGL01330:Npas3 APN 12 54048819 missense probably damaging 1.00
IGL01376:Npas3 APN 12 54044586 missense probably benign 0.01
IGL01634:Npas3 APN 12 53947163 missense probably damaging 1.00
IGL02456:Npas3 APN 12 54048767 missense probably damaging 0.99
IGL02663:Npas3 APN 12 54068908 missense probably damaging 1.00
IGL02731:Npas3 APN 12 54067795 missense probably benign 0.01
IGL02955:Npas3 APN 12 53501265 missense probably damaging 0.96
IGL03001:Npas3 APN 12 53501192 missense probably damaging 1.00
IGL03047:Npas3 APN 12 53831687 splice site probably benign
ANU05:Npas3 UTSW 12 54068074 missense possibly damaging 0.49
IGL02837:Npas3 UTSW 12 53947197 missense possibly damaging 0.79
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0042:Npas3 UTSW 12 54048841 missense probably damaging 1.00
R0396:Npas3 UTSW 12 53831745 missense probably damaging 1.00
R1687:Npas3 UTSW 12 54048875 splice site probably null
R1863:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R2004:Npas3 UTSW 12 54067897 missense possibly damaging 0.63
R2047:Npas3 UTSW 12 54068829 missense probably damaging 0.99
R2049:Npas3 UTSW 12 54062088 missense probably damaging 1.00
R2278:Npas3 UTSW 12 53640502 missense possibly damaging 0.92
R2323:Npas3 UTSW 12 54068346 missense probably damaging 1.00
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R2871:Npas3 UTSW 12 54068013 nonsense probably null
R3116:Npas3 UTSW 12 54067725 splice site probably null
R3431:Npas3 UTSW 12 54069049 missense probably damaging 0.99
R3731:Npas3 UTSW 12 53354392 missense probably benign 0.11
R4332:Npas3 UTSW 12 54062069 missense probably damaging 0.99
R4593:Npas3 UTSW 12 54068497 missense probably benign 0.08
R4601:Npas3 UTSW 12 54044578 missense probably damaging 0.99
R4654:Npas3 UTSW 12 54062132 critical splice donor site probably null
R4946:Npas3 UTSW 12 54065835 missense probably damaging 1.00
R5140:Npas3 UTSW 12 53501114 nonsense probably null
R5302:Npas3 UTSW 12 54068836 missense probably damaging 1.00
R5524:Npas3 UTSW 12 54068938 missense possibly damaging 0.64
R5735:Npas3 UTSW 12 54003479 missense probably benign 0.00
R6252:Npas3 UTSW 12 54068890 missense probably damaging 1.00
R6438:Npas3 UTSW 12 54068698 missense probably damaging 0.99
R6987:Npas3 UTSW 12 54068253 missense possibly damaging 0.94
R6994:Npas3 UTSW 12 54068793 missense probably damaging 0.96
R7304:Npas3 UTSW 12 54069041 missense probably damaging 1.00
R7684:Npas3 UTSW 12 54068826 missense probably damaging 1.00
R7724:Npas3 UTSW 12 54068341 missense possibly damaging 0.90
R7739:Npas3 UTSW 12 54068718 missense probably damaging 1.00
R7826:Npas3 UTSW 12 53831756 missense possibly damaging 0.92
R8017:Npas3 UTSW 12 54044679 missense probably damaging 1.00
R8019:Npas3 UTSW 12 54044679 missense probably damaging 1.00
R8034:Npas3 UTSW 12 53640529 missense probably damaging 1.00
X0003:Npas3 UTSW 12 54044728 splice site probably null
X0064:Npas3 UTSW 12 53354384 missense probably damaging 0.96
Z1176:Npas3 UTSW 12 53501180 missense probably damaging 0.99
Z1177:Npas3 UTSW 12 53947206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACCCATGGAGATGCTC -3'
(R):5'- AAAATGGCAGGCAACCGGTC -3'

Sequencing Primer
(F):5'- GAGATGCTCTACCACCACGTG -3'
(R):5'- GTCATCTGACCCTCTGAAGG -3'
Posted On2015-03-25