Incidental Mutation 'R3768:Pla2g5'
ID273106
Institutional Source Beutler Lab
Gene Symbol Pla2g5
Ensembl Gene ENSMUSG00000041193
Gene Namephospholipase A2, group V
SynonymssPLA2
MMRRC Submission 040745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R3768 (G1)
Quality Score184
Status Not validated
Chromosome4
Chromosomal Location138799244-138863482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 138801435 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 70 (C70S)
Ref Sequence ENSEMBL: ENSMUSP00000099571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030524] [ENSMUST00000102511] [ENSMUST00000102512] [ENSMUST00000102513]
Predicted Effect probably damaging
Transcript: ENSMUST00000030524
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030524
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102511
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099569
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102512
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099570
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102513
AA Change: C70S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099571
Gene: ENSMUSG00000041193
AA Change: C70S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PA2c 21 137 1.16e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154844
Meta Mutation Damage Score 0.9545 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the secretory phospholipase A2 family. It is located in a tightly-linked cluster of secretory phospholipase A2 genes on chromosome 1. The encoded enzyme catalyzes the hydrolysis of membrane phospholipids to generate lysophospholipids and free fatty acids including arachidonic acid. It preferentially hydrolyzes linoleoyl-containing phosphatidylcholine substrates. Secretion of this enzyme is thought to induce inflammatory responses in neighboring cells. Alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced acute zymosan-induced peritonitis and arachadonic acid metabolite release from stimulated peritoneal macrophages. Mice homozygous for a different knock-out allele exhibit reduced response to myocardial ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Abca5 T C 11: 110,313,391 R353G probably benign Het
Ank1 A G 8: 23,116,186 D1153G possibly damaging Het
Ankrd12 T C 17: 65,985,720 Y906C probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Arid4a A G 12: 71,067,119 K160R probably damaging Het
Atp8a2 T A 14: 60,044,336 H142L probably benign Het
B3gnt2 T C 11: 22,836,765 K141R probably damaging Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cmya5 A T 13: 93,096,693 I629K possibly damaging Het
Cnga4 A G 7: 105,407,680 N330S probably damaging Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Cxcl15 A C 5: 90,801,444 D156A unknown Het
D630045J12Rik A G 6: 38,142,909 S1633P probably damaging Het
Dock10 T A 1: 80,532,368 N1581I probably damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Dscaml1 T A 9: 45,732,137 F1285I possibly damaging Het
Fgf10 G T 13: 118,781,547 V124F probably damaging Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Kctd19 T C 8: 105,396,480 T101A probably benign Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lrp2 C T 2: 69,505,105 D1425N probably benign Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Ncor2 A G 5: 125,028,687 V1613A probably damaging Het
Nlgn2 C T 11: 69,828,404 V207I possibly damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr1420 G A 19: 11,896,312 G97D probably damaging Het
Olfr1426 A G 19: 12,087,940 I284T probably damaging Het
Osbpl3 G A 6: 50,348,002 P172L possibly damaging Het
Pabpc4 T A 4: 123,294,612 V338D probably damaging Het
Pdia6 T C 12: 17,270,456 V32A probably damaging Het
Pik3c3 T A 18: 30,333,273 S792R probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sap25 T A 5: 137,642,370 F171I probably damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Tarm1 A T 7: 3,497,581 S69T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp36 T C 11: 118,263,052 K846R probably damaging Het
Zfp229 A T 17: 21,745,863 H358L probably damaging Het
Other mutations in Pla2g5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03304:Pla2g5 APN 4 138804569 nonsense probably null
R0278:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R0323:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R0325:Pla2g5 UTSW 4 138800656 missense probably benign 0.40
R3767:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3769:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R3770:Pla2g5 UTSW 4 138801435 missense probably damaging 1.00
R5620:Pla2g5 UTSW 4 138804610 missense possibly damaging 0.83
R6776:Pla2g5 UTSW 4 138800653 missense probably benign 0.00
R7065:Pla2g5 UTSW 4 138800604 missense probably damaging 1.00
R7097:Pla2g5 UTSW 4 138804519 missense probably damaging 1.00
R7122:Pla2g5 UTSW 4 138804519 missense probably damaging 1.00
R7829:Pla2g5 UTSW 4 138804534 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTGAGTCTCAACTGGGACTTCC -3'
(R):5'- CTTTAACATCCAAGCACAGTGTCC -3'

Sequencing Primer
(F):5'- CCCTTTCCTGGAAGTCTAAAGAGG -3'
(R):5'- AGTGTCCCCAAGGTACCATTG -3'
Posted On2015-03-25