Incidental Mutation 'R3768:Kctd19'
ID273118
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Namepotassium channel tetramerisation domain containing 19
Synonyms4922504H04Rik
MMRRC Submission 040745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3768 (G1)
Quality Score182
Status Not validated
Chromosome8
Chromosomal Location105382807-105413502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105396480 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 101 (T101A)
Ref Sequence ENSEMBL: ENSMUSP00000130831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063071] [ENSMUST00000167294] [ENSMUST00000168888]
Predicted Effect probably benign
Transcript: ENSMUST00000063071
AA Change: T101A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: T101A

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000167294
AA Change: T101A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648
AA Change: T101A

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168888
SMART Domains Protein: ENSMUSP00000131732
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 95 4.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Abca5 T C 11: 110,313,391 R353G probably benign Het
Ank1 A G 8: 23,116,186 D1153G possibly damaging Het
Ankrd12 T C 17: 65,985,720 Y906C probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
Arid4a A G 12: 71,067,119 K160R probably damaging Het
Atp8a2 T A 14: 60,044,336 H142L probably benign Het
B3gnt2 T C 11: 22,836,765 K141R probably damaging Het
Btbd7 G A 12: 102,795,192 P578L probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cmya5 A T 13: 93,096,693 I629K possibly damaging Het
Cnga4 A G 7: 105,407,680 N330S probably damaging Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Cxcl15 A C 5: 90,801,444 D156A unknown Het
D630045J12Rik A G 6: 38,142,909 S1633P probably damaging Het
Dock10 T A 1: 80,532,368 N1581I probably damaging Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Dscaml1 T A 9: 45,732,137 F1285I possibly damaging Het
Fgf10 G T 13: 118,781,547 V124F probably damaging Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Klf3 A G 5: 64,827,217 probably null Het
Krtap12-1 G T 10: 77,720,895 V91L probably benign Het
Lrp2 C T 2: 69,505,105 D1425N probably benign Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Mypn C A 10: 63,125,707 L1035F possibly damaging Het
Ncor2 A G 5: 125,028,687 V1613A probably damaging Het
Nlgn2 C T 11: 69,828,404 V207I possibly damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr1420 G A 19: 11,896,312 G97D probably damaging Het
Olfr1426 A G 19: 12,087,940 I284T probably damaging Het
Osbpl3 G A 6: 50,348,002 P172L possibly damaging Het
Pabpc4 T A 4: 123,294,612 V338D probably damaging Het
Pdia6 T C 12: 17,270,456 V32A probably damaging Het
Pik3c3 T A 18: 30,333,273 S792R probably damaging Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Ppm1h G T 10: 122,904,122 L367F probably damaging Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sap25 T A 5: 137,642,370 F171I probably damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Tarm1 A T 7: 3,497,581 S69T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp36 T C 11: 118,263,052 K846R probably damaging Het
Zfp229 A T 17: 21,745,863 H358L probably damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R8059:Kctd19 UTSW 8 105396351 missense probably benign 0.02
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 105388517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCAGGGTGTGGGCC -3'
(R):5'- GGGGATGAATACACATAATGAGCAC -3'

Sequencing Primer
(F):5'- CTGCCCGTGACGGTACCTG -3'
(R):5'- TCTGAAATCAGCCTGTGCAG -3'
Posted On2015-03-25